Skip to content

Commit

Permalink
Updating workflows/epigenetics/cutandrun from 0.6.1 to 0.6.2
Browse files Browse the repository at this point in the history
  • Loading branch information
planemo-autoupdate committed Feb 5, 2024
1 parent ffd260f commit 8f7d405
Show file tree
Hide file tree
Showing 2 changed files with 69 additions and 17 deletions.
5 changes: 5 additions & 0 deletions workflows/epigenetics/cutandrun/CHANGELOG.md
View file
Original file line number Diff line number Diff line change
@@ -1,5 +1,10 @@
# Changelog

## [0.6.2] 2024-02-05

### Automatic update
- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1`

## [0.6.1] 2023-11-20

- Fix author in dockstore
Expand Down
81 changes: 64 additions & 17 deletions workflows/epigenetics/cutandrun/cutandrun.ga
View file
Original file line number Diff line number Diff line change
Expand Up @@ -10,7 +10,7 @@
],
"format-version": "0.1",
"license": "MIT",
"release": "0.6.1",
"release": "0.6.2",
"name": "CUTandRUN",
"steps": {
"0": {
Expand Down Expand Up @@ -177,7 +177,7 @@
},
"6": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0",
"content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1",
"errors": null,
"id": 6,
"input_connections": {
Expand All @@ -188,13 +188,14 @@
"library|r1|adapters_0|adapter_source|adapter": {
"id": 1,
"output_name": "output"
},
"library|r2|adapters2_0|adapter_source2|adapter2": {
"id": 2,
"output_name": "output"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool Cutadapt",
"name": "library"
}
],
"label": "Cutadapt (remove adapter + bad quality bases)",
"name": "Cutadapt",
"outputs": [
Expand Down Expand Up @@ -230,15 +231,15 @@
"output_name": "report"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0",
"tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1",
"tool_shed_repository": {
"changeset_revision": "8c0175e03cee",
"changeset_revision": "64172f1c1202",
"name": "cutadapt",
"owner": "lparsons",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "4.4+galaxy0",
"tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"builtin\", \"__current_case__\": 1, \"adapter\": \"TGTAGGCC\"}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\", \"minimum_length2\": null, \"maximum_length2\": null}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"cut\": \"0\", \"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "4.6+galaxy1",
"type": "tool",
"uuid": "774b0604-628f-46a1-9088-a59d082e5317",
"when": null,
Expand All @@ -259,7 +260,16 @@
"output_name": "output"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool Bowtie2",
"name": "library"
},
{
"description": "runtime parameter for tool Bowtie2",
"name": "reference_genome"
}
],
"label": "Bowtie2 map on reference",
"name": "Bowtie2",
"outputs": [
Expand Down Expand Up @@ -332,6 +342,10 @@
{
"description": "runtime parameter for tool Filter SAM or BAM, output SAM or BAM",
"name": "bed_file"
},
{
"description": "runtime parameter for tool Filter SAM or BAM, output SAM or BAM",
"name": "input1"
}
],
"label": "filter MAPQ30 concordant pairs",
Expand Down Expand Up @@ -385,7 +399,12 @@
"output_name": "output1"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool MarkDuplicates",
"name": "inputFile"
}
],
"label": "remove PCR duplicates",
"name": "MarkDuplicates",
"outputs": [
Expand Down Expand Up @@ -454,7 +473,12 @@
"output_name": "outFile"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool bedtools BAM to BED",
"name": "input"
}
],
"label": "convert BAM to BED to improve peak calling",
"name": "bedtools BAM to BED",
"outputs": [
Expand Down Expand Up @@ -514,7 +538,20 @@
"output_name": "output"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool MACS2 callpeak",
"name": "advanced_options"
},
{
"description": "runtime parameter for tool MACS2 callpeak",
"name": "effective_genome_size_options"
},
{
"description": "runtime parameter for tool MACS2 callpeak",
"name": "treatment"
}
],
"label": "Call Peaks with MACS2",
"name": "MACS2 callpeak",
"outputs": [
Expand Down Expand Up @@ -640,7 +677,12 @@
"output_name": "output_tabular"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool Search in textfiles",
"name": "infile"
}
],
"label": "summary of MACS2",
"name": "Search in textfiles",
"outputs": [
Expand Down Expand Up @@ -700,7 +742,12 @@
"output_name": "output_treat_pileup"
}
},
"inputs": [],
"inputs": [
{
"description": "runtime parameter for tool Wig/BedGraph-to-bigWig",
"name": "input1"
}
],
"label": "Bigwig from MACS2",
"name": "Wig/BedGraph-to-bigWig",
"outputs": [
Expand Down

0 comments on commit 8f7d405

Please sign in to comment.