Release 3.1.0 #679

jfy133 · 2024-10-02T12:09:09Z

`Added`

#665 - Add support for supplying pre-made bowtie host reference index (requested by @simone-pignotti, added by @jfy133)
#670 - Added --gtdbtk_pplacer_useram to run GTDBTk in memory mode rather than write to disk (requested by @harper357, fixed by @jfy133)

`Changed`

#664 - Update GTDBTk to latest version, with updated column names, update GTDB to release 220 (by @dialvarezs)
#676 - Added exit code 12 to valid SPAdes retry codes, due to OOM errors from spades-hammer (reported by @bawee, fix by @jfy133)

`Fixed`

#667 - Fix pipeline crashing if only CONCOCT selected during binning (reported and fixed by @jfy133)
#670 - Re-add missing GTDBTk parameters into GTDBTk module (reported by harper357, fixed by @jfy133)
#672 - Fix GTDB-Tk per-sample TSV files not being published in output directory (reported by @jhayer, fix by @jfy133)

`Dependencies`

Tool	Previous version	New version
GTDBTk	2.3.2	2.4.0

PR checklist

Bump versions post release

Bump GTDBTk to v2.4.0

Add support for pre-supplying host reference bowtie2 index

…binner

Improve condition so SPLIT_FASTQ skipped if only concoct selected as …

Fix gtdbtk failing if nothing in align

…timal default

…tdbtk-missing-params

Co-authored-by: Daniel Straub <[email protected]>

Fix missing GTDBTk files in outdir

Re-add unused GTDBTK parameters

Co-authored-by: Daniel Straub <[email protected]>

Add exit code 12 to SPAdes and standardise custom errorStragety formats

Release version bump for 3.1

github-actions · 2024-10-02T12:11:59Z

`nf-core lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit a4d80ac

+| ✅ 305 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   6 tests had warnings |!

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 3.1.0
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: params.validationShowHiddenParams
nextflow_config - Config variable found: params.validationSchemaIgnoreParams
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.max_cpus= 16
nextflow_config - Config default value correct: params.max_memory= 128.GB
nextflow_config - Config default value correct: params.max_time= 240.h
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
nextflow_config - Config default value correct: params.gtdbtk_pplacer_useram= false
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 23.04.0, Config: 23.04.0
readme - README Zenodo placeholder was replaced with DOI.
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (319 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: branch.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
base_config - CAT found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - SPADES found in conf/base.config and Nextflow scripts.
base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - SPADES found in conf/modules.config and Nextflow scripts.
modules_config - SPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - COMBINE_CHECKM_TSV found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
modules_config - CAT found in conf/modules.config and Nextflow scripts.
modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 2.14.1

Run details

nf-core/tools version 2.14.1
Run at 2024-10-03 14:13:11

CHANGELOG.md

nextflow_schema.json

CHANGELOG.md

Co-authored-by: Matthias Hörtenhuber <[email protected]>

CHANGELOG.md

jfy133 and others added 30 commits August 27, 2024 10:31

Bump versions

b512be5

Merge pull request #658 from nf-core/postrelease-bump

2c3987a

Bump versions post release

Update GTDBTk to v2.4.0

df02613

Changelog

e4fa8a9

Prettier

5580375

Bump GTDB release version, better changelog

080eac6

Add support for pre-supplying bowtie2 host index

f11d9ae

Merge pull request #664 from dialvarezs/dev-gtdbtk

4dd9519

Bump GTDBTk to v2.4.0

Merge pull request #665 from nf-core/bowtie2-index

fb4eb51

Add support for pre-supplying host reference bowtie2 index

Improve condition so SPLIT_FASTQ skipped if only concoct selected as …

ca8ba9d

…binner

Update subworkflows/local/binning.nf

9fc4153

Update subworkflows/local/binning.nf

fcdb518

Merge pull request #667 from nf-core/concoct-only-fix

43c5b93

Improve condition so SPLIT_FASTQ skipped if only concoct selected as …

Fix module failure when no bins

9d9e4ed

Address comments via ofifical module update

a60f2e7

Merge pull request #669 from nf-core/fix-gtdbtk

a19738b

Fix gtdbtk failing if nothing in align

Utilise missing GTDBK parameters, rename pplacer scratch due to subop…

b19d4d3

…timal default

Update CHANGELOG

1059e36

Merge branch 'dev' into gtdbtk-missing-params

46f16c4

Specify they are parameters

a3ce46a

Merge branch 'gtdbtk-missing-params' of github.com:nf-core/mag into g…

5fefcb1

…tdbtk-missing-params

Typo fixes after review from @harper357

459f418

REname scratchoff to more intiuitive name to match behaviour

6183ef0

Fix missing GTDBTk files in outdir

3b19943

Update CHANGELOG.md

bfc2c0b

Co-authored-by: Daniel Straub <[email protected]>

Merge pull request #673 from nf-core/missing-gtdbtk-files

48a3698

Fix missing GTDBTk files in outdir

Add exit code 12 to spades(hybrid), and standardise errorStrategy format

aa1f3d9

Merge branch 'dev' into gtdbtk-missing-params

c57286b

Merge pull request #671 from nf-core/gtdbtk-missing-params

32298dd

Re-add unused GTDBTK parameters

Apply suggestions from code review

868cec1

Co-authored-by: Daniel Straub <[email protected]>

jfy133 added 4 commits September 24, 2024 11:30

Merge pull request #676 from nf-core/spades-ec-12

f7865e5

Add exit code 12 to SPAdes and standardise custom errorStragety formats

Bump version for release

ce9e541

Harshil align

63ce1cb

Merge pull request #678 from nf-core/release-dump

e3b3b16

Release version bump for 3.1

jfy133 requested review from prototaxites, d4straub and CarsonJM October 2, 2024 12:09

maxulysse approved these changes Oct 2, 2024

View reviewed changes

mashehu approved these changes Oct 3, 2024

View reviewed changes

CHANGELOG.md Outdated Show resolved Hide resolved

CHANGELOG.md Outdated Show resolved Hide resolved

nextflow_schema.json Outdated Show resolved Hide resolved

jfy133 commented Oct 3, 2024

View reviewed changes

CHANGELOG.md Outdated Show resolved Hide resolved

Apply suggestions from code review

375c018

Co-authored-by: Matthias Hörtenhuber <[email protected]>

jfy133 commented Oct 3, 2024

View reviewed changes

CHANGELOG.md Outdated Show resolved Hide resolved

Update CHANGELOG.md

a4d80ac

jfy133 merged commit d744cf7 into master Oct 4, 2024
33 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release 3.1.0 #679

Release 3.1.0 #679

jfy133 commented Oct 2, 2024

github-actions bot commented Oct 2, 2024 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Release 3.1.0 #679

Release 3.1.0 #679

Conversation

jfy133 commented Oct 2, 2024

Added

Changed

Fixed

Dependencies

PR checklist

github-actions bot commented Oct 2, 2024 • edited Loading

nf-core lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

`Added`

`Changed`

`Fixed`

`Dependencies`

github-actions bot commented Oct 2, 2024 •

edited

Loading

`nf-core lint` overall result: Passed ✅ ⚠️