add and fix tests

gbouras13 · Jul 23, 2024 · 328ad0b · 328ad0b
1 parent 901e9c1
commit 328ad0b
Show file tree

Hide file tree

Showing 3 changed files with 15 additions and 1 deletion.
diff --git a/tests/test_data/overall_inputs/PP04977_pilon_subset.fasta b/tests/test_data/overall_inputs/PP04977_pilon_subset.fasta
@@ -0,0 +1,4 @@
+>NODE_3970_
+GCTCCGCACCTCGTGCAGCACCGAATGCGCCATTGGCTGCGGCGGCTTCGCAAGCGATGGCGGCGAGCCAGCCTGTGAAT
+CAGACACCTGCACCTGCTCAAGTGGCTACTCCTGCGCCCGTACAGCCATTACAGGTTAACGACGAGCCCTCTCGCGATAG
+CTTTGATCCAATGGCTGGTGCGAGTTCTCAACAAGCGCCTGCCCGTGCCGAGCAGCGTACAGTCCAGGTAG
diff --git a/tests/test_dnaapler.py b/tests/test_dnaapler.py
@@ -206,7 +206,12 @@ def test_begin_dnaapler(self):
         threads = str(8)
         gene = "terL"
         outdir = os.path.join(test_data, "bad_dir")
-        begin_dnaapler(input, outdir, threads, gene)
+        params = {
+        "--input": input,
+        "--output": outdir,
+        "--threads": threads,
+    }
+        begin_dnaapler(input, outdir, threads, gene, params)
 
     def test_end_dnaapler(self):
         time = 2324.0

diff --git a/tests/test_overall.py b/tests/test_overall.py
@@ -210,6 +210,11 @@ def test_custom(tmp_dir):
     cmd = f"dnaapler all  -i {input_fasta} -o {tmp_dir} -t 1 -f -c {custom}"
     exec_command(cmd)
 
+def test_no_overlap(tmp_dir):
+    """test no overlap"""
+    input_fasta: Path = f"{overall_test_data}/PP04977_pilon_subset.fasta"
+    cmd = f"dnaapler all  -i {input_fasta} -o {tmp_dir} -t 1 -f"
+    exec_command(cmd)
 
 def test_all_dnaa_repa(tmp_dir):
     """test all dnaa repa"""