Groot new tool and data manager

data_managers/data_manager_groot_database_downloader/.shed.yml

@@ -0,0 +1,8 @@
+categories:
+- Data Managers
+description: Download pre-clustered ARG database that are ready to be indexed
+homepage_url: https://github.com/will-rowe/groot
+long_description: GROOT is a tool to type Antibiotic Resistance Genes (ARGs) in metagenomic samples (a.k.a. Resistome Profiling). It combines variation graph representation of gene sets with an LSH indexing scheme to allow for fast classification of metagenomic reads.
+name: data_manager_groot_database_downloader
+remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/master/data_managers/data_manager_groot_database_downloader
+type: unrestricted

data_managers/data_manager_groot_database_downloader/data_manager/data_manager_groot_database_downloader.xml

@@ -0,0 +1,71 @@
+<tool id="groot_database_downloader" name="Groot get" tool_type="manage_data" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description> Download pre-clustered ARG database that are ready to be indexed</description>
+    <macros>
+        <token name="@TOOL_VERSION@">1.1.2</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+        <token name="@PROFILE@">22.05</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="3.12">python</requirement>
+        <requirement type="package" version="2024.6.2">ca-certificates</requirement>
+        <requirement type="package" version="@TOOL_VERSION@">groot</requirement>
+    </requirements>
+    <command><![CDATA[
+        if [ -f '/usr/local/ssl/cacert.pem' ] ; then export SSL_CERT_FILE='/usr/local/ssl/cacert.pem' ; fi &&
+        groot get -d '$database' --identity '$identity' &&
+        cp '$dmjson' '$out_file'
+    ]]></command>
+    <configfiles>
+        <configfile name="dmjson"><![CDATA[
+#from datetime import date
+{
+  "data_tables":{
+    "groot_database":[
+      {
+        "value": "$database.$identity-@TOOL_VERSION@-#echo date.today().strftime('%d%m%Y')#",
+        "name": "$database ($identity percent identity)",
+        "path": "/$database.$identity",
+        "version": "@TOOL_VERSION@"
+      }
+    ]
+  }
+}]]>
+        </configfile>
+    </configfiles>
+    <inputs>
+        <param name="database" type="select" label="Database name">
+            <option value="arg-annot" selected="true">ARG-annot 90% identity (default)</option>
+            <option value="resfinder">Resfinder 90% identity</option>
+            <option value="card">CARD 90% identity</option>
+            <option value="groot-db">Groot-db 90% identity, combine all sequences in ARG-annot, Resfinder and CARD</option>
+            <option value="groot-core-db">Groot-core-db 90% identity, same as groot-db but one copy of each sequence is kept and then this collection is clustered at 90% identity</option>
+         </param>
+         <param name="identity" type="select" label="Percent Identity">
+            <option value="90" selected="true">90% identity (default)</option>
+         </param>
+    </inputs>
+    <outputs>
+        <data name="out_file" format="data_manager_json" label="${tool.name}"/>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="1">
+            <param name="database" value="arg-annot"/>
+            <param name="identity" value="90"/>
+            <output name="out_file">
+                <assert_contents>
+                    <has_text text='"groot_database":'/>
+                    <has_text text='"version": "1.1.2"'/>
+                    <has_text_matching expression='"value": "arg-annot.90-1.1.2-[0-9]{8}"'/>
+                    <has_text text='"name": "arg-annot (90 percent identity)"'/>
+                    <has_text text='"path": "/arg-annot.90"'/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+        The groot get subcommand is used to download a pre-clustered ARG database that is ready to be indexed.
+    </help>
+    <citations>
+        <citation type="doi">10.5281/zenodo.1217889</citation>
+    </citations>
+</tool>

data_managers/data_manager_groot_database_downloader/data_manager_conf.xml

@@ -0,0 +1,20 @@
+<?xml version="1.0"?>
+<data_managers>
+    <data_manager tool_file="data_manager/data_manager_groot_database_downloader.xml" id="groot_database_downloader">
+        <data_table name="groot_database">
+            <output>
+                <column name="value"/>  <!-- columns that are going to be specified by the Data Manager Tool -->
+                <column name="name"/>  <!-- columns that are going to be specified by the Data Manager Tool -->
+                <column name="path" output_ref="out_file">
+                    <move type="directory">
+                        <source>${path}</source>
+                        <target base="${GALAXY_DATA_MANAGER_DATA_PATH}">groot_database/data/${value}</target>
+                    </move>
+                    <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/groot_database/data/${value}</value_translation>
+                    <value_translation type="function">abspath</value_translation>
+                </column>
+                <column name="version"/> <!-- columns that are going to be specified by the Data Manager Tool -->
+            </output>
+        </data_table>
+    </data_manager>
+</data_managers>

data_managers/data_manager_groot_database_downloader/test-data/groot_database.loc

@@ -0,0 +1,2 @@
+arg-annot.90-16102024	arg-annot (90 percent identity)	/tmp/tmpjmmj2x3o/galaxy-dev/tool-data/groot_database/data/arg-annot.90-16102024	1.1.2
+arg-annot.90-1.1.2-16102024	arg-annot (90 percent identity)	/tmp/tmpqdkgcsoq/galaxy-dev/tool-data/groot_database/data/arg-annot.90-1.1.2-16102024	1.1.2

data_managers/data_manager_groot_database_downloader/tool-data/groot_database.loc.sample

@@ -0,0 +1,3 @@
+#This is a sample file distributed with Galaxy that enables tools
+#file has this format (white space characters are TAB characters)
+#resfinder.90-v1.1.2	resfinder (90 percent identity)	300524-v1.1.2	${__HERE__}/resfinder.90    1.1.2

data_managers/data_manager_groot_database_downloader/tool_data_table_conf.xml.sample

@@ -0,0 +1,6 @@
+<tables>
+    <table name="groot_database" comment_char="#">
+        <columns>value, name, path, version</columns>
+        <file path="tool-data/groot_database.loc"/>
+    </table>
+</tables>

data_managers/data_manager_groot_database_downloader/tool_data_table_conf.xml.test

@@ -0,0 +1,7 @@
+<?xml version="1.0"?>
+<tables>
+    <table name="groot_database" comment_char="#">
+        <columns>value, name, path, version</columns>
+        <file path="${__HERE__}/test-data/groot_database.loc" />
+    </table>
+</tables>

tools/groot/.shed.yml

@@ -0,0 +1,18 @@
+name: groot
+owner: iuc
+description: GROOT is a tool to type Antibiotic Resistance Genes (ARGs) in metagenomic samples
+long_description: |
+  GROOT is a tool to type Antibiotic Resistance Genes (ARGs) in metagenomic samples (a.k.a. Resistome Profiling). 
+  It combines variation graph representation of gene sets with an LSH indexing scheme to allow for fast classification of metagenomic reads. 
+  Subsequent hierarchical local alignment of classified reads against graph traversals facilitates accurate reconstruction of full-length gene sequences using a simple scoring scheme.
+categories:
+- Metagenomics
+homepage_url: https://github.com/will-rowe/groot
+remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/master/tools/groot
+type: unrestricted
+auto_tool_repositories:
+  name_template: "{{ tool_id }}"
+  description_template: "Wrapper for the GROOT tool suite: {{ tool_name }}"
+suite:
+  name: "suite_groot"
+  description: "GROOT is a tool to type Antibiotic Resistance Genes (ARGs) in metagenomic samples"

tools/groot/groot.xml

@@ -0,0 +1,153 @@
+<tool id="groot" name="Groot" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description> align reads to references and weight variation graphs and generate report</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="xrefs"/>
+    <expand macro="requirements"/>
+    <command detect_errors="exit_code"><![CDATA[
+set -x pipefail;
+#set $extension = str($fastq.ext)
+ln -s -f '${fastq}' 'input.${extension}' &&
+groot index
+    --msaDir '$groot_db_select.fields.path'
+    --indexDir 'grootIndex'
+    --windowSize $windowSize
+    --kmerSize $kmerSize
+    --maxK $maxK
+    --maxSketchSpan $maxSketchSpan
+    --numPart $numPart
+    --sketchSize $sketchSize
+&&
+
+groot align
+    --fastq 'input.${extension}'
+    --indexDir 'grootIndex'
+    --contThresh $contThresh
+    --minKmerCov $minKmerCov
+    --log $log
+    $noAlign
+    --processors "\${GALAXY_SLOTS:-1}"
+
+| groot report
+    --covCutoff '$covCutoff'
+    $lowCov
+    > '$report_out'
+
+]]></command>
+    <inputs>
+        <param argument="--fastq" type="data" format="fastqsanger,fastqsanger.gz" label="FASTQ file(s) to align"/>
+        <section name="index" title="Index">
+            <param name="groot_db_select" type="select" label="Groot database">
+                <options from_data_table="groot_database">
+                    <validator message="No groot database is available" type="no_options"/>
+                </options>
+            </param>
+            <param argument="--windowSize" type="integer" min="0" value="100" label="Size of window to sketch graph traversals" />
+            <param argument="--kmerSize" type="integer" min="0" value="31" label="Size of k-mer" />
+            <param argument="--maxK" type="integer" min="0" value="40" label="maxK in the LSH Ensemble" />
+            <param argument="--maxSketchSpan" type="integer" min="0" value="4" label="Maximum number of identical neighbouring sketches permitted in any graph traversal" />
+            <param argument="--numPart" type="integer" min="0" value="8" label="Number of partitions in the LSH Ensemble" />
+            <param argument="--sketchSize" type="integer" min="0" value="21" label="Size of MinHash sketch" />
+        </section>
+        <section name="align" title="Align">
+            <param argument="--contThresh" type="float" min="0" max="1.0" value="0.99" label="Containment threshold for the LSH ensemble" />
+            <param argument="--minKmerCov" type="integer" min="0" value="1" label="Minimum number of k-mers covering each base of a graph segment" />
+            <param argument="--noAlign" type="boolean" truevalue="" falsevalue="--noAlign" label="Perform exact alignment?" 
+                help="If not, graphs will still be weighted using approximate read mappings"/>
+        </section>
+        <section name="report" title="Report">
+            <param argument="--covCutoff" type="float" min="0" max="1.0" value="0.97" label="Coverage cutoff for reporting ARGs" />
+            <param argument="--lowCov" type="boolean" checked="false" truevalue="--lowCov" falsevalue="" label="Report ARGs which may not be covered at the 5'/3' ends" 
+                help="If 'Yes', overrides --covCutoff option"/>
+        </section>
+    </inputs>
+    <outputs>
+        <data name="log" format="txt" label="${tool.name} on ${on_string}: Log"/>
+        <data name="report_out" format="tabular" label="${tool.name} on ${on_string}: Report"/>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="2">
+            <param name="fastq" value="bla-b7-150bp-5x.fq" ftype="fastq"/>
+            <section name="index">
+                <param name="groot_db_select" value="resfinder.90" />
+                <param name="windowSize" value="150"/>
+                <param name="kmerSize" value="31"/>
+                <param name="maxK" value="20"/>
+                <param name="maxSketchSpan" value="30"/>
+                <param name="numPart" value="8"/>
+                <param name="sketchSize" value="20"/>
+            </section>
+            <section name="align">
+                <param name="contThresh" value="0.99"/>
+                <param name="minKmerCov" value="1" />
+                <param name="noAlign" value=""/>
+            </section>
+            <section name="report">
+                <conditional name="arg_report">
+                    <param name="criteria" value="cutoff" />
+                    <param name="covCutoff" value="0.97" />
+                </conditional>
+            </section>
+            <output name="report_out" ftype="tabular">
+                <assert_contents>
+                    <has_text text="blaB-7_1_AF189304"/>
+                    <has_n_lines n="1"/>
+                    <has_n_columns n="4"/>
+                </assert_contents>
+            </output>
+            <output name="log" ftype="txt">
+                <assert_contents>
+                    <has_text text="version"/>
+                    <has_text text="1.1.2"/>
+                </assert_contents>
+            </output>
+        </test>
+        <test expect_num_outputs="2">
+            <param name="fastq" value="argannot_light-150bp-10000-reads.fq.gz" ftype="fastq.gz"/>
+            <section name="index">
+                <param name="groot_db_select" value="arg-annot.90" />
+                <param name="windowSize" value="150"/>
+                <param name="kmerSize" value="41"/>
+                <param name="maxK" value="4"/>
+                <param name="maxSketchSpan" value="30"/>
+                <param name="numPart" value="8"/>
+                <param name="sketchSize" value="21"/>
+            </section>
+            <section name="align">
+                <param name="contThresh" value="0.99"/>
+                <param name="minKmerCov" value="1" />
+                <param name="noAlign" value=""/>
+            </section>
+            <section name="report">
+                <param name="covCutoff" value="0.97" />
+                <param name="lowCov" value="True"/>
+            </section>
+            <output name="report_out" ftype="tabular">
+                <assert_contents>
+                    <has_text text="argannot~~~(Bla)VIM-9~~~AY524988:1-801"/>
+                    <has_text text="argannot~~~(Bla)VIM-20~~~GQ414736:1-801"/>
+                    <has_n_lines n="5"/>
+                    <has_n_columns n="4"/>
+                </assert_contents>
+            </output>
+            <output name="log" ftype="txt">
+                <assert_contents>
+                    <has_text text="version"/>
+                    <has_text text="1.1.2"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help><![CDATA[
+**What it does**
+
+@HELP@
+
+**Output**
+
+GROOT will output an ARG alignment file (in BAM format) that contains the graph traversals possible for each query read; the alignment file is then used by GROOT to generate a resistome profile. 
+
+    ]]></help>
+    <expand macro="citations"/>
+</tool>

tools/groot/macros.xml

@@ -0,0 +1,42 @@
+<?xml version="1.0"?>
+<macros>
+    <token name="@TOOL_VERSION@">1.1.2</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@PROFILE@">22.05</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">groot</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <xml name="xrefs">
+        <xrefs>
+            <xref type="bio.tools">groot</xref>
+        </xrefs>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/bioinformatics/bty387</citation>
+        </citations>
+    </xml>
+    <token name="HELP"><![CDATA[
+GROOT is a tool to profile Antibiotic Resistance Genes (ARGs) in metagenomic samples.
+
+The method combines variation graph representation of gene sets with an LSH Forest 
+indexing scheme to allow for fast classification of metagenomic reads using 
+similarity-search queries. Subsequent hierarchical local alignment of classified reads 
+against graph traversals facilitates accurate reconstruction of full-length gene sequences 
+using a scoring scheme. 
+
+The main advantages of GROOT over existing tools are:
+
+- quick classification of reads to candidate ARGs
+- accurate annotation of full-length ARGs
+- can run on a laptop in minutes
+
+GROOT aligns reads to ARG variation graphs, producing an alignment file that contains 
+the graph traversals possible for each query read. The alignment file is then used to 
+generate a simple resistome profile report.
+
+    ]]></token>
+</macros>

tools/groot/test-data/arg-annot.90/cluster-3.msa

@@ -0,0 +1,25 @@
+>*argannot~~~(AGly)Aac(3)-IIIc~~~L06161:106-945
+ATGTTCTCTCGTTGGTCGAAACCTCTCGTGCTTGCCGCCGTGACCCGCGCCTCGCTCGCCGCTGATCTCGCCGCGCTTGG
+CCTTGCCGCGGGCGATGCGGTCATGGTCCATGCCGCCGTCAGCAAGGTCGGCCGCCTGCTCGACGGTCCCGACACGATCA
+TCGCCGCTCTGTCCGACGCCGGTCGGCCTGCCGGCACCATCCTCGCCTATGCCGATTGGGAAGCGCGCTACGAGGACCTC
+GTGGACGAGGACGGCCGCGTGCCGCAGGAATGGCGCGAGCACATCCCACCCTTCGATCCGCGGCGCTCACGCGCGATCCG
+CGACAATGGCGTGCTTCCGGAATTCCTGCGGACGACACCGGGTGCGTTGCGCAGCGGCAATCCCGGCGCCTCGATGGTCG
+GGCTCGGCGCCAGAGCGGAATGGTTCACCGCAGACCATCCCCTCGACTACGGCTATGGCGAGGGTTCGCCGCTGGCCAGG
+CTGGTCGAAGCCGGCGGCAAGGTGCTGATGCTCGGGGCGCCGCTCGACACGCTGACCCTGCTGCACCATGCCGAGCATCT
+GGCCGACATCCCCGGCAAGCGCATCCGGCGGATCGAGGTGCCGCTGGCGACGCCGACCGGCACGCAATGGCGCATGATCG
+AGGAATTCGATACCGGCGATCCGATCGTCGAAGGTTTGGCCGAGGACTACTTCGCCGAGATCGTGACGGCGTTCCTTGCC
+GGCGGCCGAGGACGGCAGGGCTTGATCGGCACCGCGCCATCCGTGCTGGTCGATGCTGCCGCAATCACGGCTTTCGGCGT
+CGCCTGGCTGGAATCGCGCTTCGGCTCGCCCTCATCCTGA
+>consensus
+ATGTTCTCTCGTTGGTCGAAACCTCTCGTGCTTGCCGCCGTGACCCGCGCCTCGCTCGCCGCTGATCTCGCCGCGCTTGG
+CCTTGCCGCGGGCGATGCGGTCATGGTCCATGCCGCCGTCAGCAAGGTCGGCCGCCTGCTCGACGGTCCCGACACGATCA
+TCGCCGCTCTGTCCGACGCCGGTCGGCCTGCCGGCACCATCCTCGCCTATGCCGATTGGGAAGCGCGCTACGAGGACCTC
+GTGGACGAGGACGGCCGCGTGCCGCAGGAATGGCGCGAGCACATCCCACCCTTCGATCCGCGGCGCTCACGCGCGATCCG
+CGACAATGGCGTGCTTCCGGAATTCCTGCGGACGACACCGGGTGCGTTGCGCAGCGGCAATCCCGGCGCCTCGATGGTCG
+GGCTCGGCGCCAGAGCGGAATGGTTCACCGCAGACCATCCCCTCGACTACGGCTATGGCGAGGGTTCGCCGCTGGCCAGG
+CTGGTCGAAGCCGGCGGCAAGGTGCTGATGCTCGGGGCGCCGCTCGACACGCTGACCCTGCTGCACCATGCCGAGCATCT
+GGCCGACATCCCCGGCAAGCGCATCCGGCGGATCGAGGTGCCGCTGGCGACGCCGACCGGCACGCAATGGCGCATGATCG
+AGGAATTCGATACCGGCGATCCGATCGTCGAAGGTTTGGCCGAGGACTACTTCGCCGAGATCGTGACGGCGTTCCTTGCC
+GGCGGCCGAGGACGGCAGGGCTTGATCGGCACCGCGCCATCCGTGCTGGTCGATGCTGCCGCAATCACGGCTTTCGGCGT
+CGCCTGGCTGGAATCGCGCTTCGGCTCGCCCTCATCCTGA
+

tools/groot/test-data/arg-annot.90/cluster-30.msa

@@ -0,0 +1,17 @@
+>*argannot~~~(AGly)Aac6-IIa~~~M29695:707-1261
+ATGTCCGCGAGCAccccccccATAACTCTTCGCCTCATGACCGAGCGCGACCTGCCGATGCTCCATGACTGGCTCAACCG
+GCCGCACATCGTTGAGTGGTGGGGTGGCGACGAAGAGCGACCGACTCTTGATGAAGTGCTGGAACACTACCTGCCCAGAG
+CGATGGCGGAAGAGTCCGTAACACCGTACATCGCAATGCTGGGCGAGGAACCGATCGGCTATGCTCAGTCGTACGTCGCG
+CTCGGAAGCGGTGATGGCTGGTGGGAAGATGAAACTGATCCAGGAGTGCGAGGAATAGACCAGTCTCTGGCTGACCCGAC
+ACAGTTGAACAAAGGCCTAGGAACAAGGCTTGTCCGCGCTCTCGTTGAACTACTGTTCTCGGACCCCACCGTGACGAAGA
+TTCAGACCGACCCGACTCCGAACAACCATCGAGCCATACGCTGCTATGAGAAGGCAGGATTCGTGCGGGAGAAGATCATC
+ACCACGCCTGACGGGCCGGCGGTTTACATGGTTCAAACACGACAAGCCTTCGAGAGAAAGCGCGGTGTTGCCTAA
+>consensus
+ATGTCCGCGAGCACCCCCCCCATAACTCTTCGCCTCATGACCGAGCGCGACCTGCCGATGCTCCATGACTGGCTCAACCG
+GCCGCACATCGTTGAGTGGTGGGGTGGCGACGAAGAGCGACCGACTCTTGATGAAGTGCTGGAACACTACCTGCCCAGAG
+CGATGGCGGAAGAGTCCGTAACACCGTACATCGCAATGCTGGGCGAGGAACCGATCGGCTATGCTCAGTCGTACGTCGCG
+CTCGGAAGCGGTGATGGCTGGTGGGAAGATGAAACTGATCCAGGAGTGCGAGGAATAGACCAGTCTCTGGCTGACCCGAC
+ACAGTTGAACAAAGGCCTAGGAACAAGGCTTGTCCGCGCTCTCGTTGAACTACTGTTCTCGGACCCCACCGTGACGAAGA
+TTCAGACCGACCCGACTCCGAACAACCATCGAGCCATACGCTGCTATGAGAAGGCAGGATTCGTGCGGGAGAAGATCATC
+ACCACGCCTGACGGGCCGGCGGTTTACATGGTTCAAACACGACAAGCCTTCGAGAGAAAGCGCGGTGTTGCCTAA
+