modify alph_type conditionnal, remove createdb-mode parameter and TWI…

…N parameters (automatically set by tool)
galaxyproject · Nov 25, 2024 · 2e2364d · 2e2364d
1 parent 41cb56d
commit 2e2364d
Show file tree

Hide file tree

Showing 2 changed files with 35 additions and 67 deletions.
diff --git a/tools/mmseqs2/mmseqs2_easy_linclust_clustering.xml b/tools/mmseqs2/mmseqs2_easy_linclust_clustering.xml
@@ -14,18 +14,10 @@ mmseqs easy-linclust
     'result'
     'tmp'
 
-    #if '$alph_type.type' == "amino_acid"
-        --sub-mat 'blosum62.out'
-        --alph-size $alph_type.type.alph_size_amino_acid
+    #if '$alph_type.dbtype' == "1"
         --comp-bias-corr-scale $alph_type.type.comp_bias_corr_scale
-        --gap-open 11
-        --gap-extend 1
         --kmer-per-seq-scale $alph_type.type.kmer_per_seq_scale
-    #elif '$alph_type.type' == "nucleotide"
-        --sub-mat 'nucleotide.out'
-        --alph-size $alph_type.type.alph_size_nucleotide
-        --gap-open 5
-        --gap-extend 2
+    #elif '$alph_type.dbtype' == "2"
         --zdrop $alph_type.type.zdrop
         --kmer-per-seq-scale $alph_type.type.kmer_per_seq_scale
         --adjust-kmer-len $alph_type.type.adjust_kmer_len
@@ -81,9 +73,8 @@ mmseqs easy-linclust
 
     ##Misc options
     --rescore-mode $misc.rescore_mode
-    --dbtype $misc.dbtype
+    --dbtype $alph_type.dbtype
     --shuffle $misc.shuffle
-    --createdb-mode $misc.createdb_mode
     --id-offset $misc.id_offset
 
     ##Common options
@@ -104,17 +95,17 @@ mmseqs easy-linclust
     <inputs>
         <param name="input_fasta" type="data" format="fasta,fasta.gz" label="Input fasta file" help="" />
         <conditional name="alph_type">
-            <param name="type" type="select" label="Alphabet type" help="" >
-                <option value="amino_acid" selected="true">Amino acid</option>
-                <option value="nucleotide">Nucleotide</option>
+            <param argument="--dbtype" type="select" label="Input data type" help="" >
+                <option value="0" selected="true">Automatic</option>
+                <option value="1">Amino acid</option>
+                <option value="2">Nucleotides</option>
             </param>
-            <when value="amino_acid">
-                <param argument="--alph-size" name="alph_size_amino_acid" type="integer" min="2" max="21" value="21" label="Alphabet size" help=""/>
+            <when value="0"/>
+            <when value="1">
                 <param argument="--comp-bias-corr-scale" type="float" min="0" max="1" value="1" label="Scale composition bias correction" help=""/>
                 <param argument="--kmer-per-seq-scale" type="float" min="0" value="0.000" label="Scale k-mer per sequence based on sequence length" help=""/>
             </when>
-            <when value="nucleotide">
-                <param argument="--alph-size" name="alph_size_nucleotide" type="integer" min="2" max="5" value="5" label="Alphabet size" help=""/>
+            <when value="2">
                 <param argument="--zdrop" type="integer" min="0" value="40" label="Maximal allowed difference between score values before alignment is truncated" help=""/>
                 <param argument="--kmer-per-seq-scale" type="float" min="0" value="0.200" label="Scale k-mer per sequence based on sequence length" help=""/>
                 <param argument="--adjust-kmer-len" type="boolean" checked="false" truevalue="1" falsevalue="0" label="Adjust k-mer length based on specificity" help=""/>
@@ -177,16 +168,7 @@ mmseqs easy-linclust
                 <option value="3">Global alignment</option>
                 <option value="4">Longest alignment fulfilling window quality criterion</option>
             </param>
-            <param argument="--dbtype" type="select" label="Database type" help="" >
-                <option value="0" selected="true">Automatic</option>
-                <option value="1">Amino acid</option>
-                <option value="2">Nucleotides</option>
-            </param>
             <param argument="--shuffle" type="boolean" checked="true" truevalue="1" falsevalue="0" label="Shuffle input database" help=""/>
-            <param argument="--createdb-mode" type="select" label="Createdb mode" help="" >
-                <option value="0">Copy data</option>
-                <option value="1" selected="true">Soft link data and write new index (works only with single line fasta/q)</option>
-            </param>
             <param argument="--id-offset" type="integer" min="0" value="0" label="Numeric ids in index file are offset by this value" help=""/>
         </section>
         <expand macro="common_section"/>
@@ -215,6 +197,9 @@ mmseqs easy-linclust
     <tests>
         <test expect_num_outputs="3">
             <param name="input_fasta" value="light_mystery_reads.fasta" ftype="fasta"/>
+            <conditional name="alph_type">
+                <param name="dbtype" value="2"/>
+            </conditional>
             <output name="output_rep_seq" ftype="fasta">
                 <assert_contents>
                     <has_text text="TACTTCTCAGCTGTACTGTTTCTTGGTGTAGGGTCAACAACCCTTCAATGGATGTTCTCTTACTACCCAACCGATTGGGCGCACTACCGGGTCACATATGC"/>               

diff --git a/tools/mmseqs2/mmseqs2_taxonomy_assignment.xml b/tools/mmseqs2/mmseqs2_taxonomy_assignment.xml
@@ -13,8 +13,7 @@ ln -s -f '${createdb.input_fasta}' 'input' &&
 mmseqs createdb
     'input'
     'sequenceDB'
-    --dbtype '$createdb.dbtype'
-    --createdb-mode $createdb.createdb_mode
+    --dbtype '$createdb.alph_type.dbtype'
     --shuffle $createdb.shuffle &&
 
 cp -r '$createtaxdb.database_type.mmseqs2_db_select.fields.path'/database* . &&
@@ -44,20 +43,10 @@ mmseqs taxonomy
     #end if
     'output_taxonomy'
     'tmp'
-    #if str($taxonomy.alph_type.type) == "amino_acid"
-        --sub-mat 'blosum62.out'
-        --alph-size $taxonomy.alph_type.alph_size_amino_acid
-        --comp-bias-corr-scale $taxonomy.alph_type.comp_bias_corr_scale
-        --seed-sub-mat 'VTML80.out'
-        --gap-open 11
-        --gap-extend 1
-    #elif str($taxonomy.alph_type.type) == "nucleotide"
-        --sub-mat 'nucleotide.out'
-        --alph-size $taxonomy.alph_type.alph_size_nucleotide
-        --seed-sub-mat 'nucleotide.out'
-        --gap-open 5
-        --gap-extend 2
-        --zdrop $taxonomy.alph_type.zdrop
+    #if str($createdb.alph_type.dbtype) == "1"
+        --comp-bias-corr-scale $createdb.alph_type.comp_bias_corr_scale
+    #elif str($createdb.alph_type.dbtype) == "2"
+        --zdrop $createdb.alph_type.zdrop
     #end if
     ##Pre-filter options
     --add-self-matches $taxonomy.prefilter.add_self_matches
@@ -218,15 +207,20 @@ mmseqs createtsv
     <inputs>
         <section name="createdb" title="Convert FASTA/Q file(s) to MMseqs sequence DB format"  expanded="true">
             <param name="input_fasta" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input fasta file" help="" />
-            <param argument="--dbtype" type="select" label="Input type" help="" >
-                <option value="0" selected="true">Auto</option>
-                <option value="1">Amino acid</option>
-                <option value="2">Nucleotides</option>
-            </param>
-            <param argument="--createdb-mode" type="select" label="Create DB mode" help="" >
-                <option value="0" selected="true">Copy data</option>
-                <option value="1">Soft link data and write new index (works only with single line fasta/q)</option>
-            </param>
+            <conditional name="alph_type">
+                <param argument="--dbtype" type="select" label="Input type" help="" >
+                    <option value="0" selected="true">Auto</option>
+                    <option value="1">Amino acid</option>
+                    <option value="2">Nucleotides</option>
+                </param>
+                <when value="0"/>
+                <when value="1">
+                    <param argument="--comp-bias-corr-scale" type="float" min="0" max="1" value="1" label="Scale composition bias correction" help=""/>
+                </when>
+                <when value="2">
+                    <param argument="--zdrop" type="integer" min="0" value="40" label="Maximal allowed difference between score values before alignment is truncated" help=""/>
+                </when>
+            </conditional>
             <param argument="--shuffle" type="boolean" checked="true" label="Shuffle input database" truevalue="1" falsevalue="0" optional="true" help="" />
         </section>
         <section name="createtaxdb" title="Add taxonomic labels to reference sequence DB" expanded="true">
@@ -272,20 +266,6 @@ mmseqs createtsv
             <param argument="--taxon-list" type="text" optional="true" value="" label="Taxonomy ID" help="Possibly multiple values separated by ','"/>
         </section>
         <section name="taxonomy" title="Taxonomy assignment by computing the lowest common ancestor of homologs">
-            <conditional name="alph_type">
-                <param name="type" type="select" label="Alphabet type" help="" >
-                    <option value="amino_acid" selected="true">Amino acid</option>
-                    <option value="nucleotide">Nucleotide</option>
-                </param>
-                <when value="amino_acid">
-                    <param argument="--alph-size" name="alph_size_amino_acid" type="integer" min="2" max="21" value="21" label="Alphabet size" help=""/>
-                    <param argument="--comp-bias-corr-scale" type="float" min="0" max="1" value="1" label="Scale composition bias correction" help=""/>
-                </when>
-                <when value="nucleotide">
-                    <param argument="--alph-size" name="alph_size_nucleotide" type="integer" min="2" max="5" value="5" label="Alphabet size" help=""/>
-                    <param argument="--zdrop" type="integer" min="0" value="40" label="Maximal allowed difference between score values before alignment is truncated" help=""/>
-                </when>
-            </conditional>
             <section name="prefilter" title="Pre-filter">
                 <expand macro="prefilter_common_parameters" />
                 <param argument="--spaced-kmer-mode" type="select" label="Spaced k-mer mode" help="">
@@ -499,6 +479,9 @@ mmseqs createtsv
         <test expect_num_outputs="2">
             <section name="createdb">
                 <param name="input_fasta" value="light_mystery_reads.fasta" ftype="fasta"/>
+                <conditional name="alph_type">
+                    <param name="dbtype" value="2"/>
+                </conditional>
             </section>
             <section name="createtaxdb">
                 <conditional name="database_type">