diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/Assembly-Hifi-only-VGP3.ga b/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/Assembly-Hifi-only-VGP3.ga index af19023b9..c172d90ad 100644 --- a/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/Assembly-Hifi-only-VGP3.ga +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/Assembly-Hifi-only-VGP3.ga @@ -13,7 +13,7 @@ } ], "format-version": "0.1", - "release": "0.1.2", + "release": "0.1.3", "license": "CC-BY-4.0", "name": "Assembly-Hifi-only-VGP3", "steps": { @@ -208,7 +208,7 @@ }, "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1", "errors": null, "id": 7, "input_connections": { @@ -217,7 +217,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cutadapt", + "name": "library" + } + ], "label": null, "name": "Cutadapt", "outputs": [ @@ -243,15 +248,15 @@ "output_name": "out1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1", "tool_shed_repository": { - "changeset_revision": "8c0175e03cee", + "changeset_revision": "64172f1c1202", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"35\", \"match_read_wildcards\": \" \", \"revcomp\": true}, \"filter_options\": {\"discard_trimmed\": true, \"discard_untrimmed\": false, \"minimum_length\": null, \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.4+galaxy0", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"35\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": true}, \"filter_options\": {\"discard_trimmed\": true, \"discard_untrimmed\": false, \"minimum_length\": null, \"maximum_length\": null, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"builtin\", \"__current_case__\": 1, \"adapter\": \"TGTAGGCC\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"builtin\", \"__current_case__\": 1, \"adapter\": \"TGTAGGCC\"}, \"single_noindels\": false}]}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"cut\": \"0\", \"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.6+galaxy1", "type": "tool", "uuid": "f679b5eb-cc26-4005-9499-3ad2eb4698d4", "when": null, @@ -268,7 +273,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Search in textfiles", + "name": "infile" + } + ], "label": null, "name": "Search in textfiles", "outputs": [ @@ -290,7 +300,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -400,7 +410,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Replace Text", + "name": "infile" + } + ], "label": null, "name": "Replace Text", "outputs": [ @@ -422,7 +437,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/1.1.2", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -436,7 +451,7 @@ }, "12": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy1", "errors": null, "id": 12, "input_connections": { @@ -449,7 +464,16 @@ "output_name": "out1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Hifiasm", + "name": "filter_bits" + }, + { + "description": "runtime parameter for tool Hifiasm", + "name": "mode" + } + ], "label": null, "name": "Hifiasm", "outputs": [ @@ -519,15 +543,15 @@ "output_name": "raw_unitigs" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy1", "tool_shed_repository": { - "changeset_revision": "0ee0c3089254", + "changeset_revision": "df25d4fb79b7", "name": "hifiasm", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"advanced_options\": {\"advanced_selector\": \"blank\", \"__current_case__\": 0}, \"assembly_options\": {\"assembly_selector\": \"blank\", \"__current_case__\": 0}, \"bins_out\": false, \"filter_bits\": {\"__class__\": \"ConnectedValue\"}, \"hic_partition\": {\"hic_partition_selector\": \"blank\", \"__current_case__\": 0}, \"log_out\": true, \"mode\": {\"mode_selector\": \"standard\", \"__current_case__\": 0, \"reads\": {\"__class__\": \"ConnectedValue\"}}, \"ont_integration\": {\"ont_integration_selector\": \"blank\", \"__current_case__\": 0}, \"purge_options\": {\"purge_selector\": \"set\", \"__current_case__\": 1, \"purge_level\": \"0\", \"similarity_threshold\": \"0.75\", \"minimum_overlap\": \"1\", \"purge_max\": null, \"n_hap\": null}, \"scaffolding_options\": {\"scaffold_selector\": \"blank\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.19.8+galaxy0", + "tool_version": "0.19.8+galaxy1", "type": "tool", "uuid": "cecbcd76-97f0-4e7a-9c90-061d3e5be432", "when": null, @@ -555,7 +579,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Convert", + "name": "input" + } + ], "label": null, "name": "Convert", "outputs": [ @@ -598,7 +627,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -662,7 +700,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -726,7 +773,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -797,7 +853,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + }, + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -864,7 +929,12 @@ "output_name": "primary_contig_graph" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -916,7 +986,12 @@ "output_name": "alternate_contig_graph" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -968,7 +1043,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cut", + "name": "input" + } + ], "label": null, "name": "Cut", "outputs": [ @@ -1007,7 +1087,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Busco", + "name": "input" + } + ], "label": null, "name": "Busco", "outputs": [ @@ -1101,7 +1186,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Merqury", + "name": "mode" + } + ], "label": null, "name": "Merqury", "outputs": [ @@ -1221,6 +1311,7 @@ "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "format-version": "0.1", "name": "gfastats_data_prep", "steps": { @@ -1262,7 +1353,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Sort", + "name": "input" + } + ], "label": null, "name": "Sort", "outputs": [ @@ -1301,7 +1397,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -1323,7 +1424,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -1346,7 +1447,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Datamash", + "name": "in_file" + } + ], "label": null, "name": "Datamash", "outputs": [ @@ -1391,7 +1497,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -1436,7 +1547,12 @@ "output_name": "out_file" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Parse parameter value", + "name": "input1" + } + ], "label": null, "name": "Parse parameter value", "outputs": [ @@ -1524,7 +1640,12 @@ "output_name": "out1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], "label": null, "name": "Compute", "outputs": [ @@ -1568,7 +1689,7 @@ } }, "tags": "", - "uuid": "11447c1e-f42c-4781-b32d-a1ca5aea440c" + "uuid": "b554d52d-43aa-4671-becf-1833d715d5f7" }, "tool_id": null, "type": "subworkflow", @@ -1597,6 +1718,7 @@ "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "format-version": "0.1", "name": "gfastats_data_prep", "steps": { @@ -1638,7 +1760,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Sort", + "name": "input" + } + ], "label": null, "name": "Sort", "outputs": [ @@ -1677,7 +1804,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -1699,7 +1831,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -1722,7 +1854,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Datamash", + "name": "in_file" + } + ], "label": null, "name": "Datamash", "outputs": [ @@ -1767,7 +1904,12 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -1812,7 +1954,12 @@ "output_name": "out_file" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Parse parameter value", + "name": "input1" + } + ], "label": null, "name": "Parse parameter value", "outputs": [ @@ -1900,7 +2047,12 @@ "output_name": "out1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], "label": null, "name": "Compute", "outputs": [ @@ -1944,7 +2096,7 @@ } }, "tags": "", - "uuid": "ecf0c757-0833-4d48-99bd-31be4a0df1ad" + "uuid": "bed84e4f-ff69-4e3c-89b4-9124e318e335" }, "tool_id": null, "type": "subworkflow", @@ -1963,7 +2115,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Parse parameter value", + "name": "input1" + } + ], "label": "Estimated genome size", "name": "Parse parameter value", "outputs": [ @@ -2042,6 +2199,7 @@ "subworkflow": { "a_galaxy_workflow": "true", "annotation": "", + "comments": [], "creator": [ { "class": "Organization", @@ -2192,7 +2350,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "exp" + }, + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -2241,7 +2408,16 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Add column", + "name": "exp" + }, + { + "description": "runtime parameter for tool Add column", + "name": "input" + } + ], "label": null, "name": "Add column", "outputs": [ @@ -2290,7 +2466,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Concatenate datasets", + "name": "inputs" + } + ], "label": null, "name": "Concatenate datasets", "outputs": [ @@ -2335,7 +2516,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cut", + "name": "input" + } + ], "label": null, "name": "Cut", "outputs": [ @@ -2374,7 +2560,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cut", + "name": "input" + } + ], "label": null, "name": "Cut", "outputs": [ @@ -2413,7 +2604,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], "label": "Nx Plot", "name": "Scatterplot with ggplot2", "outputs": [ @@ -2473,7 +2669,12 @@ "output_name": "out_file1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], "label": "Size Plot", "name": "Scatterplot with ggplot2", "outputs": [ @@ -2524,7 +2725,7 @@ } }, "tags": "", - "uuid": "44d7cbb1-6bc1-461c-81b1-889aea24de25" + "uuid": "5bfd6107-18c4-494d-b5bc-a2f4515bb822" }, "tool_id": null, "type": "subworkflow", @@ -2558,7 +2759,12 @@ "output_name": "integer_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -2615,7 +2821,12 @@ "output_name": "integer_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "input_file" + } + ], "label": null, "name": "gfastats", "outputs": [ @@ -2668,7 +2879,12 @@ "output_name": "stats" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -2690,7 +2906,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -2713,7 +2929,12 @@ "output_name": "stats" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Text reformatting", + "name": "infile" + } + ], "label": null, "name": "Text reformatting", "outputs": [ @@ -2735,7 +2956,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -2762,7 +2983,16 @@ "output_name": "outfile" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Join", + "name": "infile1" + }, + { + "description": "runtime parameter for tool Join", + "name": "infile2" + } + ], "label": null, "name": "Join", "outputs": [ @@ -2786,7 +3016,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", + "changeset_revision": "d698c222f354", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -2811,4 +3041,4 @@ ], "uuid": "166e7ec4-d3f1-4e18-b81b-2559e7fb2e76", "version": 3 -} +} \ No newline at end of file diff --git a/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/CHANGELOG.md b/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/CHANGELOG.md index 21cd3be41..ebae9a0b7 100644 --- a/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3/CHANGELOG.md @@ -1,5 +1,11 @@ # Changelog +## [0.1.3] 2024-02-05 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1` +- `toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.8+galaxy1` + ## [0.1.2] 2023-11-14