diff --git a/tools/falco/falco.xml b/tools/falco/falco.xml index 7d12090a805..9498236de5b 100644 --- a/tools/falco/falco.xml +++ b/tools/falco/falco.xml @@ -1,7 +1,7 @@ An alternative, more performant implementation of FastQC for high throughput sequence quality control - 1.2.3 + 1.2.4 0 @@ -74,28 +74,81 @@ + - - + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + - - + + + + + + - - + + + + + + - + - - + + + + + + + - + - - - - - - - + + + + + + - - + + + + + + - - + + + + + + - + - - - - + + + + + + >Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ Sequence length 1-108 #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content warn +>>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG 1 0 0 0 0 0.0203874 0 -2 0 0 0 0 0.0815494 0 -3 0 0 0 0 0.142712 0 -4 0 0 0 0 0.183486 0 -5 0 0 0 0 0.285423 0 -6 0 0 0 0 0.38736 0 -7 0 0 0 0 0.489297 0 -8 0 0 0 0 0.591233 0 -9 0 0 0 0 0.672783 0 -10 0 0 0 0 0.754332 0 -11 0 0 0 0 0.835882 0 -12 0 0 0 0 0.917431 0 -13 0 0 0 0 1.01937 0 -14 0 0 0 0 1.1213 0 -15 0 0 0 0 1.24363 0 -16 0 0 0 0 1.34557 0 -17 0 0 0 0 1.46789 0 -18 0 0 0 0 1.59021 0 -19 0 0 0 0 1.67176 0 -20 0.122324 0 0 0 1.75331 0 -21 0.122324 0 0 0 1.83486 0 -22 0.122324 0 0 0 1.89602 0 -23 0.122324 0 0 0 1.95719 0 -24 0.122324 0 0 0 2.01835 0 -25 0.122324 0 0 0 2.07951 0 -26 0.122324 0 0 0 2.14067 0 -27 0.142712 0 0 0 2.20183 0 -28 0.183486 0 0 0 2.263 0 -29 0.224261 0 0 0 2.32416 0 -30 0.224261 0 0 0 2.38532 0 -31 0.224261 0 0 0 2.44648 0 -32 0.224261 0 0 0 2.50765 0 -33 0.224261 0 0 0 2.60958 0 -34 0.224261 0 0 0 2.71152 0 -35 0.265036 0 0 0 2.81346 0 -36 0.285423 0 0 0 2.89501 0 -37 0.326198 0 0 0 2.99694 0 -38 0.407747 0 0 0 3.09888 0 -39 0.468909 0 0 0 3.20082 0 -40 0.468909 0 0 0 3.30275 0 -41 0.468909 0 0 0 3.40469 0 -42 0.468909 0 0 0 3.48624 0 -43 0.468909 0 0 0 3.56779 0 -44 0.468909 0 0 0 3.60856 0 -45 0.468909 0 0 0 3.62895 0 -46 0.468909 0 0 0 3.64934 0 -47 0.468909 0 0 0 3.66972 0 -48 0.468909 0 0 0 3.69011 0 -49 0.468909 0 0 0 3.7105 0 -50 0.468909 0 0 0 3.7105 0 -51 0.468909 0 0 0 3.7105 0 -52 0.468909 0 0 0 3.7105 0 -53 0.468909 0 0 0 3.7105 0 -54 0.468909 0 0 0 3.7105 0 -55 0.468909 0 0 0 3.7105 0 -56 0.468909 0 0 0 3.7105 0 -57 0.468909 0 0 0 3.7105 0 -58 0.468909 0 0 0 3.7105 0 -59 0.468909 0 0 0 3.73089 0 -60 0.468909 0 0 0 3.75127 0 -61 0.468909 0 0 0 3.77166 0 -62 0.468909 0 0 0 3.81244 0 -63 0.468909 0 0 0 3.85321 0 -64 0.468909 0 0 0 3.89399 0 -65 0.468909 0 0 0 3.93476 0 -66 0.468909 0 0 0 3.97554 0 -67 0.468909 0 0 0 4.01631 0 -68 0.468909 0 0 0 4.05708 0 -69 0.468909 0 0 0 4.09786 0 -70 0.468909 0 0 0 4.13863 0 -71 0.468909 0 0 0 4.17941 0 -72 0.468909 0 0 0 4.22018 0 -73 0.468909 0 0 0 4.26096 0 -74 0.489297 0 0 0 4.32212 0 -75 0.489297 0 0 0 4.38328 0 -76 0.489297 0 0 0 4.42406 0 -77 0.489297 0 0 0 4.46483 0 -78 0.489297 0 0 0 4.50561 0 -79 0.489297 0 0 0 4.54638 0 -80 0.489297 0 0 0 4.58716 0 -81 0.489297 0 0 0 4.62793 0 -82 0.489297 0 0 0 4.66871 0 -83 0.509684 0 0 0 4.70948 0 -84 0.509684 0 0 0 4.75025 0 -85 0.509684 0 0 0 4.79103 0 -86 0.509684 0 0 0 4.8318 0 -87 0.509684 0 0 0 4.91335 0 -88 0.509684 0 0 0 4.9949 0 -89 0.509684 0 0 0 5.05607 0 -90 0.509684 0 0 0 5.09684 0 -91 0.509684 0 0 0 5.158 0 -92 0.570846 0 0 0 5.21916 0 -93 0.632008 0 0 0 5.28033 0 -94 0.632008 0 0 0 5.34149 0 -95 0.632008 0 0 0 5.40265 0 -96 0.632008 0 0 0 5.46381 0 -97 0.632008 0 0 0 5.52497 0 -98 0.632008 0 0 0 5.52497 0 -99 0.632008 0 0 0 5.52497 0 -100 0.632008 0 0 0 5.52497 0 -101 0.632008 0 0 0 5.52497 0 -102 0.632008 0 0 0 5.52497 0 -103 0.632008 0 0 0 5.52497 0 -104 0.632008 0 0 0 5.52497 0 -105 0.632008 0 0 0 5.52497 0 -106 0.632008 0 0 0 5.52497 0 -107 0.632008 0 0 0 5.52497 0 -108 0.632008 0 0 0 5.52497 0 +2 0 0 0 0 0.0611621 0 +3 0 0 0 0 0.0611621 0 +4 0 0 0 0 0.0611621 0 +5 0 0 0 0 0.122324 0 +6 0 0 0 0 0.122324 0 +7 0 0 0 0 0.122324 0 +8 0 0 0 0 0.142712 0 +9 0 0 0 0 0.142712 0 +10 0 0 0 0 0.142712 0 +11 0 0 0 0 0.142712 0 +12 0 0 0 0 0.142712 0 +13 0 0 0 0 0.163099 0 +14 0 0 0 0 0.163099 0 +15 0 0 0 0 0.183486 0 +16 0 0 0 0 0.203874 0 +17 0 0 0 0 0.224261 0 +18 0 0 0 0 0.224261 0 +19 0 0 0 0 0.224261 0 +20 0.122324 0 0 0 0.244648 0 +21 0.122324 0 0 0 0.244648 0 +22 0.122324 0 0 0 0.244648 0 +23 0.122324 0 0 0 0.244648 0 +24 0.122324 0 0 0 0.244648 0 +25 0.122324 0 0 0 0.244648 0 +26 0.122324 0 0 0 0.244648 0 +27 0.142712 0 0 0 0.244648 0 +28 0.183486 0 0 0 0.244648 0 +29 0.224261 0 0 0 0.244648 0 +30 0.224261 0 0 0 0.244648 0 +31 0.224261 0 0 0 0.244648 0 +32 0.224261 0 0 0 0.244648 0 +33 0.224261 0 0 0 0.285423 0 +34 0.224261 0 0 0 0.285423 0 +35 0.265036 0 0 0 0.30581 0 +36 0.285423 0 0 0 0.30581 0 +37 0.326198 0 0 0 0.326198 0 +38 0.407747 0 0 0 0.326198 0 +39 0.468909 0 0 0 0.326198 0 +40 0.468909 0 0 0 0.326198 0 +41 0.468909 0 0 0 0.326198 0 +42 0.468909 0 0 0 0.326198 0 +43 0.468909 0 0 0 0.326198 0 +44 0.468909 0 0 0 0.326198 0 +45 0.468909 0 0 0 0.326198 0 +46 0.468909 0 0 0 0.326198 0 +47 0.468909 0 0 0 0.326198 0 +48 0.468909 0 0 0 0.326198 0 +49 0.468909 0 0 0 0.326198 0 +50 0.468909 0 0 0 0.326198 0 +51 0.468909 0 0 0 0.326198 0 +52 0.468909 0 0 0 0.326198 0 +53 0.468909 0 0 0 0.326198 0 +54 0.468909 0 0 0 0.326198 0 +55 0.468909 0 0 0 0.326198 0 +56 0.468909 0 0 0 0.326198 0 +57 0.468909 0 0 0 0.326198 0 +58 0.468909 0 0 0 0.326198 0 +59 0.468909 0 0 0 0.326198 0 +60 0.468909 0 0 0 0.326198 0 +61 0.468909 0 0 0 0.326198 0 +62 0.468909 0 0 0 0.326198 0 +63 0.468909 0 0 0 0.326198 0 +64 0.468909 0 0 0 0.326198 0 +65 0.468909 0 0 0 0.326198 0 +66 0.468909 0 0 0 0.326198 0 +67 0.468909 0 0 0 0.326198 0 +68 0.468909 0 0 0 0.326198 0 +69 0.468909 0 0 0 0.326198 0 +70 0.468909 0 0 0 0.326198 0 +71 0.468909 0 0 0 0.326198 0 +72 0.468909 0 0 0 0.326198 0 +73 0.468909 0 0 0 0.326198 0 +74 0.468909 0 0 0 0.326198 0 +75 0.468909 0 0 0 0.326198 0 +76 0.468909 0 0 0 0.326198 0 +77 0.468909 0 0 0 0.326198 0 +78 0.468909 0 0 0 0.326198 0 +79 0.468909 0 0 0 0.326198 0 +80 0.468909 0 0 0 0.326198 0 +81 0.468909 0 0 0 0.326198 0 +82 0.468909 0 0 0 0.326198 0 +83 0.468909 0 0 0 0.326198 0 +84 0.468909 0 0 0 0.326198 0 +85 0.468909 0 0 0 0.326198 0 +86 0.468909 0 0 0 0.326198 0 +87 0.468909 0 0 0 0.326198 0 +88 0.468909 0 0 0 0.326198 0 +89 0.468909 0 0 0 0.326198 0 +90 0.468909 0 0 0 0.326198 0 +91 0.468909 0 0 0 0.326198 0 +92 0.468909 0 0 0 0.326198 0 +93 0.468909 0 0 0 0.326198 0 +94 0.468909 0 0 0 0.326198 0 +95 0.468909 0 0 0 0.326198 0 +96 0.468909 0 0 0 0.326198 0 +97 0.468909 0 0 0 0.326198 0 +98 0.468909 0 0 0 0.326198 0 +99 0.468909 0 0 0 0.326198 0 +100 0.468909 0 0 0 0.326198 0 +101 0.468909 0 0 0 0.326198 0 +102 0.468909 0 0 0 0.326198 0 +103 0.468909 0 0 0 0.326198 0 +104 0.468909 0 0 0 0.326198 0 +105 0.468909 0 0 0 0.326198 0 +106 0.468909 0 0 0 0.326198 0 +107 0.468909 0 0 0 0.326198 0 +108 0.468909 0 0 0 0.326198 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_data_adapters.txt b/tools/falco/test-data/fastqc_data_adapters.txt index 9e431dcd88b..a2ccc7081c7 100644 --- a/tools/falco/test-data/fastqc_data_adapters.txt +++ b/tools/falco/test-data/fastqc_data_adapters.txt @@ -1,4 +1,4 @@ -##Falco 1.2.3 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1672,39 +1672,39 @@ ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit 71 0.468909 0 0 0 0 72 0.468909 0 0 0 0 73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +74 0.468909 0 0 0 0 +75 0.468909 0 0 0 0 +76 0.468909 0 0 0 0 +77 0.468909 0 0 0 0 +78 0.468909 0 0 0 0 +79 0.468909 0 0 0 0 +80 0.468909 0 0 0 0 +81 0.468909 0 0 0 0 +82 0.468909 0 0 0 0 +83 0.468909 0 0 0 0 +84 0.468909 0 0 0 0 +85 0.468909 0 0 0 0 +86 0.468909 0 0 0 0 +87 0.468909 0 0 0 0 +88 0.468909 0 0 0 0 +89 0.468909 0 0 0 0 +90 0.468909 0 0 0 0 +91 0.468909 0 0 0 0 +92 0.468909 0 0 0 0 +93 0.468909 0 0 0 0 +94 0.468909 0 0 0 0 +95 0.468909 0 0 0 0 +96 0.468909 0 0 0 0 +97 0.468909 0 0 0 0 +98 0.468909 0 0 0 0 +99 0.468909 0 0 0 0 +100 0.468909 0 0 0 0 +101 0.468909 0 0 0 0 +102 0.468909 0 0 0 0 +103 0.468909 0 0 0 0 +104 0.468909 0 0 0 0 +105 0.468909 0 0 0 0 +106 0.468909 0 0 0 0 +107 0.468909 0 0 0 0 +108 0.468909 0 0 0 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_data_contaminant_summary.txt b/tools/falco/test-data/fastqc_data_contaminant_summary.txt deleted file mode 100644 index 109484ffc6f..00000000000 --- a/tools/falco/test-data/fastqc_data_contaminant_summary.txt +++ /dev/null @@ -1,11 +0,0 @@ -PASS Basic Statistics 1000trimmed_fastq -PASS Per base sequence quality 1000trimmed_fastq -FAIL Per tile sequence quality 1000trimmed_fastq -PASS Per sequence quality scores 1000trimmed_fastq -FAIL Per base sequence content 1000trimmed_fastq -WARN Per sequence GC content 1000trimmed_fastq -PASS Per base N content 1000trimmed_fastq -WARN Sequence Length Distribution 1000trimmed_fastq -PASS Sequence Duplication Levels 1000trimmed_fastq -WARN Overrepresented sequences 1000trimmed_fastq -PASS Adapter Content 1000trimmed_fastq diff --git a/tools/falco/test-data/fastqc_data_contaminants.txt b/tools/falco/test-data/fastqc_data_contaminants.txt index 4cd55952a12..5218d3e1cdf 100644 --- a/tools/falco/test-data/fastqc_data_contaminants.txt +++ b/tools/falco/test-data/fastqc_data_contaminants.txt @@ -1,4 +1,4 @@ -##Falco 1.2.3 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1595,116 +1595,116 @@ Sequence length 1-108 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source -ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit +ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 Test sequence >>END_MODULE ->>Adapter Content warn +>>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG 1 0 0 0 0 0.0203874 0 -2 0 0 0 0 0.0815494 0 -3 0 0 0 0 0.142712 0 -4 0 0 0 0 0.183486 0 -5 0 0 0 0 0.285423 0 -6 0 0 0 0 0.38736 0 -7 0 0 0 0 0.489297 0 -8 0 0 0 0 0.591233 0 -9 0 0 0 0 0.672783 0 -10 0 0 0 0 0.754332 0 -11 0 0 0 0 0.835882 0 -12 0 0 0 0 0.917431 0 -13 0 0 0 0 1.01937 0 -14 0 0 0 0 1.1213 0 -15 0 0 0 0 1.24363 0 -16 0 0 0 0 1.34557 0 -17 0 0 0 0 1.46789 0 -18 0 0 0 0 1.59021 0 -19 0 0 0 0 1.67176 0 -20 0.122324 0 0 0 1.75331 0 -21 0.122324 0 0 0 1.83486 0 -22 0.122324 0 0 0 1.89602 0 -23 0.122324 0 0 0 1.95719 0 -24 0.122324 0 0 0 2.01835 0 -25 0.122324 0 0 0 2.07951 0 -26 0.122324 0 0 0 2.14067 0 -27 0.142712 0 0 0 2.20183 0 -28 0.183486 0 0 0 2.263 0 -29 0.224261 0 0 0 2.32416 0 -30 0.224261 0 0 0 2.38532 0 -31 0.224261 0 0 0 2.44648 0 -32 0.224261 0 0 0 2.50765 0 -33 0.224261 0 0 0 2.60958 0 -34 0.224261 0 0 0 2.71152 0 -35 0.265036 0 0 0 2.81346 0 -36 0.285423 0 0 0 2.89501 0 -37 0.326198 0 0 0 2.99694 0 -38 0.407747 0 0 0 3.09888 0 -39 0.468909 0 0 0 3.20082 0 -40 0.468909 0 0 0 3.30275 0 -41 0.468909 0 0 0 3.40469 0 -42 0.468909 0 0 0 3.48624 0 -43 0.468909 0 0 0 3.56779 0 -44 0.468909 0 0 0 3.60856 0 -45 0.468909 0 0 0 3.62895 0 -46 0.468909 0 0 0 3.64934 0 -47 0.468909 0 0 0 3.66972 0 -48 0.468909 0 0 0 3.69011 0 -49 0.468909 0 0 0 3.7105 0 -50 0.468909 0 0 0 3.7105 0 -51 0.468909 0 0 0 3.7105 0 -52 0.468909 0 0 0 3.7105 0 -53 0.468909 0 0 0 3.7105 0 -54 0.468909 0 0 0 3.7105 0 -55 0.468909 0 0 0 3.7105 0 -56 0.468909 0 0 0 3.7105 0 -57 0.468909 0 0 0 3.7105 0 -58 0.468909 0 0 0 3.7105 0 -59 0.468909 0 0 0 3.73089 0 -60 0.468909 0 0 0 3.75127 0 -61 0.468909 0 0 0 3.77166 0 -62 0.468909 0 0 0 3.81244 0 -63 0.468909 0 0 0 3.85321 0 -64 0.468909 0 0 0 3.89399 0 -65 0.468909 0 0 0 3.93476 0 -66 0.468909 0 0 0 3.97554 0 -67 0.468909 0 0 0 4.01631 0 -68 0.468909 0 0 0 4.05708 0 -69 0.468909 0 0 0 4.09786 0 -70 0.468909 0 0 0 4.13863 0 -71 0.468909 0 0 0 4.17941 0 -72 0.468909 0 0 0 4.22018 0 -73 0.468909 0 0 0 4.26096 0 -74 0.489297 0 0 0 4.32212 0 -75 0.489297 0 0 0 4.38328 0 -76 0.489297 0 0 0 4.42406 0 -77 0.489297 0 0 0 4.46483 0 -78 0.489297 0 0 0 4.50561 0 -79 0.489297 0 0 0 4.54638 0 -80 0.489297 0 0 0 4.58716 0 -81 0.489297 0 0 0 4.62793 0 -82 0.489297 0 0 0 4.66871 0 -83 0.509684 0 0 0 4.70948 0 -84 0.509684 0 0 0 4.75025 0 -85 0.509684 0 0 0 4.79103 0 -86 0.509684 0 0 0 4.8318 0 -87 0.509684 0 0 0 4.91335 0 -88 0.509684 0 0 0 4.9949 0 -89 0.509684 0 0 0 5.05607 0 -90 0.509684 0 0 0 5.09684 0 -91 0.509684 0 0 0 5.158 0 -92 0.570846 0 0 0 5.21916 0 -93 0.632008 0 0 0 5.28033 0 -94 0.632008 0 0 0 5.34149 0 -95 0.632008 0 0 0 5.40265 0 -96 0.632008 0 0 0 5.46381 0 -97 0.632008 0 0 0 5.52497 0 -98 0.632008 0 0 0 5.52497 0 -99 0.632008 0 0 0 5.52497 0 -100 0.632008 0 0 0 5.52497 0 -101 0.632008 0 0 0 5.52497 0 -102 0.632008 0 0 0 5.52497 0 -103 0.632008 0 0 0 5.52497 0 -104 0.632008 0 0 0 5.52497 0 -105 0.632008 0 0 0 5.52497 0 -106 0.632008 0 0 0 5.52497 0 -107 0.632008 0 0 0 5.52497 0 -108 0.632008 0 0 0 5.52497 0 +2 0 0 0 0 0.0611621 0 +3 0 0 0 0 0.0611621 0 +4 0 0 0 0 0.0611621 0 +5 0 0 0 0 0.122324 0 +6 0 0 0 0 0.122324 0 +7 0 0 0 0 0.122324 0 +8 0 0 0 0 0.142712 0 +9 0 0 0 0 0.142712 0 +10 0 0 0 0 0.142712 0 +11 0 0 0 0 0.142712 0 +12 0 0 0 0 0.142712 0 +13 0 0 0 0 0.163099 0 +14 0 0 0 0 0.163099 0 +15 0 0 0 0 0.183486 0 +16 0 0 0 0 0.203874 0 +17 0 0 0 0 0.224261 0 +18 0 0 0 0 0.224261 0 +19 0 0 0 0 0.224261 0 +20 0.122324 0 0 0 0.244648 0 +21 0.122324 0 0 0 0.244648 0 +22 0.122324 0 0 0 0.244648 0 +23 0.122324 0 0 0 0.244648 0 +24 0.122324 0 0 0 0.244648 0 +25 0.122324 0 0 0 0.244648 0 +26 0.122324 0 0 0 0.244648 0 +27 0.142712 0 0 0 0.244648 0 +28 0.183486 0 0 0 0.244648 0 +29 0.224261 0 0 0 0.244648 0 +30 0.224261 0 0 0 0.244648 0 +31 0.224261 0 0 0 0.244648 0 +32 0.224261 0 0 0 0.244648 0 +33 0.224261 0 0 0 0.285423 0 +34 0.224261 0 0 0 0.285423 0 +35 0.265036 0 0 0 0.30581 0 +36 0.285423 0 0 0 0.30581 0 +37 0.326198 0 0 0 0.326198 0 +38 0.407747 0 0 0 0.326198 0 +39 0.468909 0 0 0 0.326198 0 +40 0.468909 0 0 0 0.326198 0 +41 0.468909 0 0 0 0.326198 0 +42 0.468909 0 0 0 0.326198 0 +43 0.468909 0 0 0 0.326198 0 +44 0.468909 0 0 0 0.326198 0 +45 0.468909 0 0 0 0.326198 0 +46 0.468909 0 0 0 0.326198 0 +47 0.468909 0 0 0 0.326198 0 +48 0.468909 0 0 0 0.326198 0 +49 0.468909 0 0 0 0.326198 0 +50 0.468909 0 0 0 0.326198 0 +51 0.468909 0 0 0 0.326198 0 +52 0.468909 0 0 0 0.326198 0 +53 0.468909 0 0 0 0.326198 0 +54 0.468909 0 0 0 0.326198 0 +55 0.468909 0 0 0 0.326198 0 +56 0.468909 0 0 0 0.326198 0 +57 0.468909 0 0 0 0.326198 0 +58 0.468909 0 0 0 0.326198 0 +59 0.468909 0 0 0 0.326198 0 +60 0.468909 0 0 0 0.326198 0 +61 0.468909 0 0 0 0.326198 0 +62 0.468909 0 0 0 0.326198 0 +63 0.468909 0 0 0 0.326198 0 +64 0.468909 0 0 0 0.326198 0 +65 0.468909 0 0 0 0.326198 0 +66 0.468909 0 0 0 0.326198 0 +67 0.468909 0 0 0 0.326198 0 +68 0.468909 0 0 0 0.326198 0 +69 0.468909 0 0 0 0.326198 0 +70 0.468909 0 0 0 0.326198 0 +71 0.468909 0 0 0 0.326198 0 +72 0.468909 0 0 0 0.326198 0 +73 0.468909 0 0 0 0.326198 0 +74 0.468909 0 0 0 0.326198 0 +75 0.468909 0 0 0 0.326198 0 +76 0.468909 0 0 0 0.326198 0 +77 0.468909 0 0 0 0.326198 0 +78 0.468909 0 0 0 0.326198 0 +79 0.468909 0 0 0 0.326198 0 +80 0.468909 0 0 0 0.326198 0 +81 0.468909 0 0 0 0.326198 0 +82 0.468909 0 0 0 0.326198 0 +83 0.468909 0 0 0 0.326198 0 +84 0.468909 0 0 0 0.326198 0 +85 0.468909 0 0 0 0.326198 0 +86 0.468909 0 0 0 0.326198 0 +87 0.468909 0 0 0 0.326198 0 +88 0.468909 0 0 0 0.326198 0 +89 0.468909 0 0 0 0.326198 0 +90 0.468909 0 0 0 0.326198 0 +91 0.468909 0 0 0 0.326198 0 +92 0.468909 0 0 0 0.326198 0 +93 0.468909 0 0 0 0.326198 0 +94 0.468909 0 0 0 0.326198 0 +95 0.468909 0 0 0 0.326198 0 +96 0.468909 0 0 0 0.326198 0 +97 0.468909 0 0 0 0.326198 0 +98 0.468909 0 0 0 0.326198 0 +99 0.468909 0 0 0 0.326198 0 +100 0.468909 0 0 0 0.326198 0 +101 0.468909 0 0 0 0.326198 0 +102 0.468909 0 0 0 0.326198 0 +103 0.468909 0 0 0 0.326198 0 +104 0.468909 0 0 0 0.326198 0 +105 0.468909 0 0 0 0.326198 0 +106 0.468909 0 0 0 0.326198 0 +107 0.468909 0 0 0 0.326198 0 +108 0.468909 0 0 0 0.326198 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_data_customlimits.txt b/tools/falco/test-data/fastqc_data_customlimits.txt deleted file mode 100644 index 4cd55952a12..00000000000 --- a/tools/falco/test-data/fastqc_data_customlimits.txt +++ /dev/null @@ -1,1710 +0,0 @@ -##Falco 1.2.3 ->>Basic Statistics pass -#Measure Value -Filename 1000trimmed_fastq -File type Conventional base calls -Encoding Sanger / Illumina 1.9 -Total Sequences 4905 -Sequences flagged as poor quality 0 -Sequence length 1-108 -%GC 41 ->>END_MODULE ->>Per base sequence quality pass -#Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile -1 29.2828 31 27 33 23 34 -2 28.8329 30 27 32 22 33 -3 28.897 30 27 32 23 34 -4 29.0068 30 27 32 23 34 -5 28.9378 30 27 32 22 34 -6 29.0029 30 27 32 23 34 -7 28.8998 30 27 32 22 34 -8 28.9007 30 27 32 22 33 -9 28.7546 30 27 32 22 34 -10-11 28.8221 30 27 32 22.5 33 -12-13 28.749 30 26.5 32 22 33 -14-15 28.5337 30 26 32 22 33.5 -16-17 28.5266 30 26 32 22 33 -18-19 28.6834 30 26 32 22.5 33 -20-21 28.3701 29.5 26 32 22 33 -22-23 28.1859 29 26 32 22 33 -24-25 28.1301 29 26 32 21.5 33 -26-27 28.0758 29 26 32 21.5 33 -28-29 27.828 29 25 32 21 33 -30-31 27.7928 29 25 31.5 21 33 -32-33 27.491 28 25 31 21 33 -34-35 27.3572 28 24.5 31 21 33 -36-37 27.0622 28 24 31 20.5 33 -38-39 27.238 28 24 31 21 33 -40-41 27.029 28 24 31 20.5 33 -42-43 26.9086 27 24 31 20.5 33 -44-45 26.632 27 24 30 20 32 -46-47 26.8304 27.5 24 31 20.5 32 -48-49 26.4317 27 23.5 30 20 32 -50-51 26.219 27 23 30 20 32 -52-53 25.9257 26.5 22.5 29.5 19.5 31.5 -54-55 27.9952 29.5 25.5 31.5 20.5 33 -56-57 30.4109 31.5 28.5 33 25.5 34 -58-59 30.4084 31.5 28.5 33 26 34 -60-61 30.4448 31.5 29 33 26 34 -62-63 30.4404 31.5 29 33 25.5 34 -64-65 30.4417 31.5 29 33 25.5 34 -66-67 30.5114 32 29 33 25.5 34 -68-69 30.0512 31 28 33 24.5 34 -70-71 30.2761 31 29 33 25 34 -72-73 30.3855 31.5 29 33 25.5 34 -74-75 30.2135 31 28.5 33 25.5 34 -76-77 29.6789 31 28 33 24.5 34 -78-79 30.0191 31 28 33 24.5 34 -80-81 29.6642 31 27.5 33 24 34 -82-83 29.6535 31 28 32.5 24.5 34 -84-85 29.4256 30.5 27 32 24 34 -86-87 29.3406 30 27 32.5 24 34 -88-89 28.7857 30 27 32 22.5 33.5 -90-91 28.6675 29.5 26 32 23 33 -92-93 28.5659 29 26 32 23 33 -94-95 28.2717 29 26 32 22.5 33 -96-97 27.9496 29 25.5 31 22 33 -98-99 27.3152 28 25 31 21.5 33 -100-101 27.6147 28 25 31 21.5 33 -102-103 27.1962 28 24.5 31 21 33 -104-105 26.8709 27.5 24 31 20 32.5 -106-107 26.3676 27 23.5 30 20.5 32 -108 27.5651 28 24 31 22 33 ->>END_MODULE ->>Per tile sequence quality fail -#Tile Base Mean -0 1 -29.4857 -0 2 -28.7721 -0 3 -28.5832 -0 4 -28.7282 -0 5 -28.9662 -0 6 -28.9765 -0 7 -29.0324 -0 8 -28.9563 -0 9 -28.4479 -0 10 -28.2935 -0 11 -28.6264 -0 12 -28.711 -0 13 -28.5163 -0 14 -28.3915 -0 15 -28.2392 -0 16 -28.5304 -0 17 -28.3975 -0 18 -28.5859 -0 19 -28.6272 -0 20 -28.1273 -0 21 -28.2058 -0 22 -28.1046 -0 23 -28.3908 -0 24 -28.0801 -0 25 -28.0111 -0 26 -27.9571 -0 27 -28.1062 -0 28 -27.7915 -0 29 -27.6043 -0 30 -27.7709 -0 31 -27.5781 -0 32 -27.8211 -0 33 -27.6197 -0 34 -27.447 -0 35 -27.3368 -0 36 -27.2226 -0 37 -27.2582 -0 38 -27.2825 -0 39 -26.7901 -0 40 -26.9377 -0 41 -27.17 -0 42 -27.1488 -0 43 -26.1931 -0 44 -26.6119 -0 45 -26.5613 -0 46 -26.7864 -0 47 -26.3367 -0 48 -26.2903 -0 49 -25.7095 -0 50 -26.3457 -0 51 -26.0927 -0 52 -25.7055 -0 53 -24.9716 -0 54 -26 -0 55 -30.4161 -0 56 -30.3869 -0 57 -30.1825 -0 58 -29.6569 -0 59 -30.0876 -0 60 -30.146 -0 61 -30.4891 -0 62 -30.9197 -0 63 -30.0511 -0 64 -29.5255 -0 65 -30.0956 -0 66 -30.4559 -0 67 -30.0588 -0 68 -30.1176 -0 69 -29.9853 -0 70 -30.4191 -0 71 -30.1029 -0 72 -30.2206 -0 73 -30.2132 -0 74 -29.2721 -0 75 -29.25 -0 76 -29.7206 -0 77 -29.8015 -0 78 -29.7794 -0 79 -29.6838 -0 80 -29.5956 -0 81 -29.4412 -0 82 -29.3824 -0 83 -29.375 -0 84 -29.6176 -0 85 -29.1544 -0 86 -29.2059 -0 87 -29.0074 -0 88 -28.8162 -0 89 -28.3603 -0 90 -28.0809 -0 91 -28.8309 -0 92 -28.5882 -0 93 -28.1618 -0 94 -27.8897 -0 95 -28.0074 -0 96 -28.1471 -0 97 -27.6471 -0 98 -27.5662 -0 99 -27.4485 -0 100 -27.4044 -0 101 -26.9265 -0 102 -27.2132 -0 103 -26.5882 -0 104 -26.8603 -0 105 -26.2868 -0 106 -26.0588 -0 107 -25.1343 -0 108 -27.2314 -1 1 0.904969 -1 2 0.618551 -1 3 0.463713 -1 4 -0.165716 -1 5 -0.0790766 -1 6 0.136407 -1 7 0.0643768 -1 8 -0.311171 -1 9 0.352106 -1 10 0.23988 -1 11 -0.059757 -1 12 -0.982196 -1 13 0.0260938 -1 14 0.367111 -1 15 1.12283 -1 16 0.00406913 -1 17 0.374399 -1 18 0.128427 -1 19 0.154569 -1 20 0.911943 -1 21 0.264783 -1 22 -0.124558 -1 23 -0.615325 -1 24 -0.794396 -1 25 -0.0315502 -1 26 -0.957143 -1 27 -0.780108 -1 28 -0.204584 -1 29 -0.343425 -1 30 0.540213 -1 31 -0.200347 -1 32 0.0425501 -1 33 0.213661 -1 34 0.124409 -1 35 0.419328 -1 36 0.0700681 -1 37 -0.437669 -1 38 -1.33516 -1 39 -0.654941 -1 40 0.170365 -1 41 -1.22718 -1 42 -0.266407 -1 43 0.473534 -1 44 -0.248236 -1 45 0.00117925 -1 46 -0.108988 -1 47 -0.30335 -1 48 -0.0980149 -1 49 -0.361671 -1 50 -0.302201 -1 51 -0.807001 -1 52 0.294521 -1 53 -1.12163 -1 54 0 -1 55 1.21552 -1 56 0.98156 -1 57 -0.656166 -1 58 -0.0253554 -1 59 -0.982328 -1 60 -1.40914 -1 61 -0.752209 -1 62 -1.13023 -1 63 -0.20899 -1 64 -1.26239 -1 65 -0.428922 -1 66 -1.06699 -1 67 0.885621 -1 68 0.0490196 -1 69 1.01471 -1 70 1.41422 -1 71 0.674837 -1 72 0.334967 -1 73 -0.602124 -1 74 -0.0498366 -1 75 -0.0833333 -1 76 -0.887255 -1 77 0.198529 -1 78 -0.668301 -1 79 0.705065 -1 80 -0.262255 -1 81 -1.10784 -1 82 0.506536 -1 83 -0.819444 -1 84 0.493464 -1 85 -0.154412 -1 86 0.627451 -1 87 -0.00735294 -1 88 1.18382 -1 89 0.750817 -1 90 0.585784 -1 91 -0.664216 -1 92 -1.2549 -1 93 0.504902 -1 94 0.110294 -1 95 -0.618464 -1 96 0.186275 -1 97 -0.202614 -1 98 0.489379 -1 99 -0.504085 -1 100 0.0955882 -1 101 0.740196 -1 102 -0.268791 -1 103 -0.699346 -1 104 0.250817 -1 105 -0.953431 -1 106 -0.392157 -1 107 -1.41211 -1 108 -0.878464 -2 1 0.530738 -2 2 -0.526172 -2 3 -0.829064 -2 4 -1.23641 -2 5 -0.542445 -2 6 -0.252358 -2 7 -1.1574 -2 8 -0.0836046 -2 9 -0.11456 -2 10 -0.351146 -2 11 -0.806424 -2 12 -0.791009 -2 13 -1.31628 -2 14 0.0459906 -2 15 -1.0309 -2 16 -0.721903 -2 17 -1.63666 -2 18 0.0569986 -2 19 -0.432127 -2 20 -0.127273 -2 21 -0.280805 -2 22 -0.929558 -2 23 -0.740836 -2 24 -0.874982 -2 25 -0.511142 -2 26 0.0984127 -2 27 -0.106195 -2 28 -0.379776 -2 29 -1.39217 -2 30 -2.25575 -2 31 -1.89062 -2 32 -1.38359 -2 33 -2.84548 -2 34 -2.41476 -2 35 -2.23677 -2 36 -2.40119 -2 37 -2.52741 -2 38 -2.0133 -2 39 -2.16508 -2 40 -1.06274 -2 41 0.258531 -2 42 -1.81543 -2 43 -1.03524 -2 44 -1.71714 -2 45 -1.09073 -2 46 -0.0989078 -2 47 -3.64918 -2 48 -1.07604 -2 49 -2.32488 -2 50 -0.845679 -2 51 -2.19272 -2 52 -1.50548 -2 53 -1.57163 -2 54 -3.9 -2 55 1.80616 -2 56 -0.053528 -2 57 0.595296 -2 58 -4.3236 -2 59 -2.30981 -2 60 1.18735 -2 61 -0.933496 -2 62 -1.36415 -2 63 -0.60665 -2 64 -0.636659 -2 65 -3.87337 -2 66 -1.01144 -2 67 -1.72549 -2 68 -0.00653595 -2 69 -2.31863 -2 70 -1.08578 -2 71 -3.32516 -2 72 -2.3317 -2 73 -0.65768 -2 74 0.61683 -2 75 0.638889 -2 76 -0.831699 -2 77 -1.35703 -2 78 -1.55719 -2 79 -0.572712 -2 80 -1.15114 -2 81 1.3366 -2 82 1.1732 -2 83 -1.59722 -2 84 -2.06209 -2 85 -4.82108 -2 86 -2.98366 -2 87 -3.78513 -2 88 -2.0384 -2 89 -3.24918 -2 90 -2.52533 -2 91 -3.49755 -2 92 -1.47712 -2 93 -2.16176 -2 94 -2.66748 -2 95 0.103758 -2 96 -2.36928 -2 97 -2.0915 -2 98 -2.7884 -2 99 -1.22631 -2 100 0.0400327 -2 101 -3.92647 -2 102 -1.8799 -2 103 -2.03268 -2 104 -1.86029 -2 105 -2.95343 -2 106 0.0522876 -2 107 -1.91211 -2 108 -2.94569 -3 1 -0.172223 -3 2 -0.339238 -3 3 0.670569 -3 4 0.347542 -3 5 0.503524 -3 6 -0.914957 -3 7 0.798372 -3 8 0.231168 -3 9 -0.6737 -3 10 0.14203 -3 11 -0.223198 -3 12 -0.415927 -3 13 0.29728 -3 14 -0.0294405 -3 15 -0.221377 -3 16 -0.601842 -3 17 -1.23682 -3 18 -1.22222 -3 19 -0.778193 -3 20 0.684048 -3 21 -0.436574 -3 22 0.0915208 -3 23 0.569164 -3 24 1.00322 -3 25 -0.181355 -3 26 -0.659271 -3 27 -0.795084 -3 28 -0.745029 -3 29 0.465473 -3 30 -0.212758 -3 31 0.00327035 -3 32 -0.00713277 -3 33 -0.224323 -3 34 -0.400508 -3 35 0.00469366 -3 36 0.602385 -3 37 0.00497608 -3 38 1.74525 -3 39 0.238495 -3 40 -0.967155 -3 41 0.314808 -3 42 0.302853 -3 43 -0.160875 -3 44 -2.07854 -3 45 -0.927987 -3 46 0.146926 -3 47 -0.372398 -3 48 1.01737 -3 49 1.21358 -3 50 1.21954 -3 51 1.31638 -3 52 -0.387298 -3 53 -0.521631 -3 54 -1.8 -3 55 -0.216058 -3 56 1.11314 -3 57 1.16752 -3 58 0.493066 -3 59 0.312409 -3 60 0.254015 -3 61 1.01095 -3 62 0.730292 -3 63 -0.701095 -3 64 0.374453 -3 65 -0.245588 -3 66 0.194118 -3 67 0.891176 -3 68 -0.767647 -3 69 0.464706 -3 70 -0.0691176 -3 71 -1.60294 -3 72 -2.62059 -3 73 -1.51324 -3 74 -0.772059 -3 75 -0.65 -3 76 -0.420588 -3 77 -0.351471 -3 78 -0.329412 -3 79 -1.53382 -3 80 -1.44559 -3 81 -1.74118 -3 82 -1.38235 -3 83 -0.475 -3 84 -1.51765 -3 85 0.145588 -3 86 -0.305882 -3 87 -0.307353 -3 88 -1.11618 -3 89 -0.660294 -3 90 0.869118 -3 91 -0.0808824 -3 92 1.51176 -3 93 -0.761765 -3 94 -2.23971 -3 95 0.742647 -3 96 0.352941 -3 97 -1.04706 -3 98 -2.86618 -3 99 -0.398529 -3 100 0.445588 -3 101 -0.626471 -3 102 0.836765 -3 103 0.911765 -3 104 0.839706 -3 105 1.41324 -3 106 -0.508824 -3 107 0.0235664 -3 108 -0.668905 -4 1 -0.00946526 -4 2 0.421474 -4 3 -0.599291 -4 4 -0.36756 -4 5 -0.310436 -4 6 -0.373047 -4 7 0.381396 -4 8 0.236651 -4 9 -0.851402 -4 10 -0.293454 -4 11 -0.11699 -4 12 0.0248399 -4 13 -0.138921 -4 14 -0.0141509 -4 15 -0.258465 -4 16 0.80292 -4 17 1.13308 -4 18 0.169243 -4 19 0.148261 -4 20 0.0564007 -4 21 -0.0833558 -4 22 -0.125391 -4 23 -0.474169 -4 24 -0.746777 -4 25 0.233302 -4 26 0.865079 -4 27 0.00491642 -4 28 -0.413763 -4 29 -0.715406 -4 30 -0.498171 -4 31 -0.53267 -4 32 -0.588528 -4 33 0.0946136 -4 34 0.35298 -4 35 0.191008 -4 36 -0.389282 -4 37 -0.22961 -4 38 -0.539671 -4 39 0.121688 -4 40 0.304681 -4 41 -1.10943 -4 42 0.00275482 -4 43 0.0649315 -4 44 0.745271 -4 45 -0.116876 -4 46 -1.00863 -4 47 -0.256683 -4 48 0.418011 -4 49 0.457169 -4 50 -2.05996 -4 51 -0.759382 -4 52 -0.455479 -4 53 0.659948 -4 54 -0.166667 -4 55 -0.471614 -4 56 -0.109084 -4 57 -0.738037 -4 58 -1.04582 -4 59 -0.698702 -4 60 0.0206813 -4 61 -0.155718 -4 62 0.746959 -4 63 -1.60665 -4 64 -0.636659 -4 65 -0.0400327 -4 66 -0.678105 -4 67 -1.55882 -4 68 -0.839869 -4 69 -0.429739 -4 70 -1.03023 -4 71 0.674837 -4 72 0.501634 -4 73 0.0645425 -4 74 -0.716503 -4 75 0.638889 -4 76 0.612745 -4 77 -0.857026 -4 78 -0.723856 -4 79 -0.0171569 -4 80 -0.762255 -4 81 0.614379 -4 82 -0.993464 -4 83 -1.26389 -4 84 -0.339869 -4 85 -0.154412 -4 86 -0.428105 -4 87 -0.451797 -4 88 -0.593954 -4 89 -0.304739 -4 90 -0.0808824 -4 91 0.780229 -4 92 -1.58824 -4 93 -0.939542 -4 94 -0.167484 -4 95 -1.28513 -4 96 0.24183 -4 97 1.4085 -4 98 0.0449346 -4 99 -1.67075 -4 100 -1.01552 -4 101 -0.982026 -4 102 0.564542 -4 103 -0.143791 -4 104 -1.91585 -4 105 -0.508987 -4 106 -0.503268 -4 107 1.15979 -4 108 -0.481405 -5 1 1.02228 -5 2 0.307291 -5 3 0.385092 -5 4 0.481462 -5 5 0.0499557 -5 6 0.894472 -5 7 0.361045 -5 8 0.643668 -5 9 0.83544 -5 10 1.02858 -5 11 0.746458 -5 12 0.594076 -5 13 0.173376 -5 14 0.832628 -5 15 0.181818 -5 16 -0.184959 -5 17 0.250617 -5 18 -0.151896 -5 19 0.7453 -5 20 0.715865 -5 21 0.834195 -5 22 0.997483 -5 23 0.405083 -5 24 0.239038 -5 25 -0.606887 -5 26 1.86104 -5 27 1.18926 -5 28 0.799368 -5 29 1.00036 -5 30 1.0198 -5 31 0.793968 -5 32 0.607485 -5 33 0.689852 -5 34 0.0529801 -5 35 0.472754 -5 36 0.427385 -5 37 0.891818 -5 38 0.9226 -5 39 1.39911 -5 40 1.03448 -5 41 1.60774 -5 42 0.394097 -5 43 -0.102224 -5 44 0.974335 -5 45 0.645576 -5 46 -0.165718 -5 47 0.806174 -5 48 -1.62366 -5 49 0.570503 -5 50 0.17606 -5 51 0.342067 -5 52 -0.401132 -5 53 -1.01511 -5 54 -0.130435 -5 55 0.311214 -5 56 -0.432316 -5 57 0.999336 -5 58 1.07034 -5 59 0.0942269 -5 60 -0.555076 -5 61 0.329131 -5 62 -0.419708 -5 63 1.26709 -5 64 1.29263 -5 65 1.44987 -5 66 0.362299 -5 67 0.941176 -5 68 0.700535 -5 69 -1.80348 -5 70 0.35361 -5 71 2.21524 -5 72 1.00668 -5 73 0.74131 -5 74 0.273396 -5 75 -0.386364 -5 76 0.643048 -5 77 0.698529 -5 78 -0.870321 -5 79 -1.13837 -5 80 1.04078 -5 81 0.286096 -5 82 0.117647 -5 83 0.352273 -5 84 0.336898 -5 85 0.300134 -5 86 0.930481 -5 87 1.08356 -5 88 -0.179813 -5 89 0.0487968 -5 90 -0.580882 -5 91 -0.0127005 -5 92 1.09358 -5 93 1.38369 -5 94 1.11029 -5 95 0.947193 -5 96 -0.237968 -5 97 -0.283422 -5 98 0.752005 -5 99 0.824198 -5 100 -0.449866 -5 101 0.846257 -5 102 -1.57687 -5 103 -0.270053 -5 104 -0.496658 -5 105 0.122326 -5 106 0.0775401 -5 107 -1.31615 -5 108 -0.881405 -6 1 -0.394747 -6 2 -0.105407 -6 3 -0.0680107 -6 4 0.0899661 -6 5 -0.0570825 -6 6 0.417444 -6 7 -0.123306 -6 8 -1.77451 -6 9 -0.932742 -6 10 0.237796 -6 11 0.811076 -6 12 1.13274 -6 13 -0.391279 -6 14 -2.32901 -6 15 -0.145484 -6 16 -0.186664 -6 17 -1.05378 -6 18 -0.804609 -6 19 -1.17564 -6 20 -1.57889 -6 21 -0.334837 -6 22 0.185765 -6 23 -0.390836 -6 24 -0.75753 -6 25 -1.33372 -6 26 -1.69908 -6 27 -0.141909 -6 28 -0.311541 -6 29 0.0207055 -6 30 -0.379593 -6 31 1.24006 -6 32 -0.571086 -6 33 -0.198619 -6 34 0.395085 -6 35 0.941008 -6 36 0.944052 -6 37 2.74182 -6 38 1.46747 -6 39 0.584924 -6 40 -1.25024 -6 41 -0.236707 -6 42 1.38457 -6 43 1.40687 -6 44 1.32146 -6 45 1.83868 -6 46 1.81359 -6 47 -0.60335 -6 48 -2.62366 -6 49 -0.352354 -6 50 1.15432 -6 51 -0.692715 -6 52 0.0722983 -6 53 0.13948 -6 54 1.44444 -6 55 -1.41606 -6 56 -1.49797 -6 57 -1.18248 -6 58 0.454177 -6 59 1.46796 -6 60 1.7429 -6 61 1.28873 -6 62 0.969181 -6 63 1.17113 -6 64 0.918897 -6 65 1.57108 -6 66 1.87745 -6 67 -0.72549 -6 68 0.771242 -6 69 0.903595 -6 70 0.580882 -6 71 -3.21405 -6 72 0.00163399 -6 73 0.00898693 -6 74 -1.16095 -6 75 0.305556 -6 76 0.0571895 -6 77 -0.468137 -6 78 1.3317 -6 79 0.982843 -6 80 1.73775 -6 81 0.336601 -6 82 0.173203 -6 83 0.291667 -6 84 -0.173203 -6 85 0.623366 -6 86 -1.4281 -6 87 0.32598 -6 88 1.07271 -6 89 1.63971 -6 90 0.585784 -6 91 2.39134 -6 92 0.189542 -6 93 -0.161765 -6 94 -0.889706 -6 95 -1.56291 -6 96 1.29739 -6 97 0.464052 -6 98 1.2116 -6 99 2.21814 -6 100 1.48448 -6 101 -1.48203 -6 102 -2.21324 -6 103 -0.143791 -6 104 1.69526 -6 105 -0.508987 -6 106 -0.281046 -6 107 -0.0232172 -6 108 2.1436 -7 1 -1.03404 -7 2 0.582765 -7 3 0.0942571 -7 4 0.529849 -7 5 -0.366173 -7 6 0.356838 -7 7 -0.0990641 -7 8 0.112634 -7 9 1.90925 -7 10 1.02797 -7 11 0.262465 -7 12 0.251954 -7 13 2.44526 -7 14 1.45464 -7 15 0.240766 -7 16 0.829586 -7 17 1.32247 -7 18 1.49414 -7 19 -0.187249 -7 20 -0.447273 -7 21 1.0742 -7 22 -1.46456 -7 23 0.849164 -7 24 0.95989 -7 25 1.90552 -7 26 -0.582143 -7 27 -1.14786 -7 28 0.344823 -7 29 1.77666 -7 30 0.514816 -7 31 0.421875 -7 32 -0.821086 -7 33 1.13033 -7 34 1.44772 -7 35 0.189546 -7 36 -0.169983 -7 37 1.26813 -7 38 0.717472 -7 39 -0.790076 -7 40 0.00962523 -7 41 1.61943 -7 42 -0.569813 -7 43 -0.0820219 -7 44 0.665906 -7 45 -1.14956 -7 46 -1.25307 -7 47 0.19665 -7 48 -0.356989 -7 49 -1.64283 -7 50 -1.27901 -7 51 0.490618 -7 52 0.127854 -7 53 0.195035 -7 54 0.916667 -7 55 -0.0827251 -7 56 -1.13686 -7 57 -0.599148 -7 58 -0.656934 -7 59 0.662409 -7 60 -0.312652 -7 61 0.260949 -7 62 0.413625 -7 63 1.69891 -7 64 1.72445 -7 65 0.571078 -7 66 -1.03922 -7 67 -0.142157 -7 68 -0.867647 -7 69 1.51471 -7 70 0.747549 -7 71 1.56373 -7 72 0.696078 -7 73 -0.546569 -7 74 -0.938725 -7 75 0.166667 -7 76 -0.637255 -7 77 1.53186 -7 78 0.803922 -7 79 1.48284 -7 80 -0.178922 -7 81 -1.52451 -7 82 0.20098 -7 83 0.125 -7 84 -0.867647 -7 85 0.178922 -7 86 -0.789216 -7 87 0.659314 -7 88 -0.816176 -7 89 -1.77696 -7 90 -0.497549 -7 91 0.335784 -7 92 -0.421569 -7 93 -1.16176 -7 94 -0.973039 -7 95 1.15931 -7 96 -0.980392 -7 97 0.102941 -7 98 0.683824 -7 99 -0.198529 -7 100 -1.07108 -7 101 -0.426471 -7 102 -0.629902 -7 103 -3.2549 -7 104 -1.52696 -7 105 0.296569 -7 106 -0.22549 -7 107 0.0323383 -7 108 0.404959 -8 1 -1.36801 -8 2 -0.00736804 -8 3 0.181544 -8 4 0.786936 -8 5 0.190077 -8 6 -0.570246 -8 7 1.1551 -8 8 0.481168 -8 9 -0.104144 -8 10 -0.980954 -8 11 -0.220174 -8 12 0.257741 -8 13 -1.5808 -8 14 -0.165703 -8 15 -0.271493 -8 16 -1.06375 -8 17 0.0358025 -8 18 0.827935 -8 19 0.821027 -8 20 -1.78245 -8 21 0.0904915 -8 22 0.203135 -8 23 0.724549 -8 24 0.23989 -8 25 0.308858 -8 26 -0.37381 -8 27 1.01881 -8 28 1.03455 -8 29 -0.647773 -8 30 -0.901333 -8 31 -0.665082 -8 32 1.588 -8 33 0.332709 -8 34 -0.208925 -8 35 -0.622484 -8 36 -0.772615 -8 37 -0.508182 -8 38 -0.582528 -8 39 1.40992 -8 40 -0.885112 -8 41 -1.17004 -8 42 0.684573 -8 43 -0.304244 -8 44 -0.317754 -8 45 0.938679 -8 46 1.40109 -8 47 1.47582 -8 48 1.13825 -8 49 -0.852354 -8 50 2.4725 -8 51 0.807285 -8 52 1.29452 -8 53 2.77837 -8 54 4.25 -8 55 0.458942 -8 56 0.613139 -8 57 0.0675182 -8 58 0.468066 -8 59 0.787409 -8 60 0.229015 -8 61 -0.364051 -8 62 0.205292 -8 63 0.948905 -8 64 1.47445 -8 65 0.529412 -8 66 1.16912 -8 67 -0.558824 -8 68 1.50735 -8 69 0.264706 -8 70 -3.29412 -8 71 -0.602941 -8 72 1.52941 -8 73 0.911765 -8 74 -0.272059 -8 75 1.875 -8 76 -1.72059 -8 77 -0.426471 -8 78 1.97059 -8 79 3.06618 -8 80 1.27941 -8 81 1.68382 -8 82 1.61765 -8 83 2.25 -8 84 1.88235 -8 85 2.59559 -8 86 1.79412 -8 87 0.992647 -8 88 1.68382 -8 89 1.13971 -8 90 0.0441176 -8 91 0.794118 -8 92 1.28676 -8 93 2.58824 -8 94 3.11029 -8 95 1.24265 -8 96 1.22794 -8 97 0.602941 -8 98 0.433824 -8 99 3.42647 -8 100 1.84559 -8 101 3.32353 -8 102 2.41176 -8 103 3.28676 -8 104 3.13971 -8 105 1.33824 -8 106 1.94118 -8 107 2.61567 -8 108 3.0186 -9 1 -0.439144 -9 2 -0.772074 -9 3 0.254047 -9 4 0.48607 -9 5 0.546022 -9 6 0.0722848 -9 7 -1.61776 -9 8 -0.688039 -9 9 -0.228381 -9 10 -0.0434537 -9 11 0.0485763 -9 12 0.699247 -9 13 0.562668 -9 14 -0.641509 -9 15 0.0385433 -9 16 0.851939 -9 17 0.573057 -9 18 -0.203506 -9 19 -0.0390141 -9 20 -0.24492 -9 21 -0.539138 -9 22 0.332942 -9 23 -0.297086 -9 24 0.26364 -9 25 0.301358 -9 26 0.342857 -9 27 0.527139 -9 28 0.0751259 -9 29 0.223292 -9 30 0.194619 -9 31 0.279018 -9 32 0.000342309 -9 33 1.15811 -9 34 0.738165 -9 35 0.432461 -9 36 0.319052 -9 37 -1.09152 -9 38 -0.152093 -9 39 0.253402 -9 40 0.366605 -9 41 0.734721 -9 42 0.803621 -9 43 -0.143133 -9 44 1.27048 -9 45 0.751179 -9 46 0.213592 -9 47 4.09189 -9 48 2.42396 -9 49 -0.209497 -9 50 -1.27425 -9 51 1.59959 -9 52 3.38543 -9 53 1.66473 -9 54 0.909091 -9 55 -0.416058 -9 56 0.340411 -9 57 0.908427 -9 58 0.88852 -9 59 1.45786 -9 60 0.854015 -9 61 -0.670869 -9 62 -0.0106171 -9 63 -1.50564 -9 64 0.928998 -9 65 -0.00467914 -9 66 1.08957 -9 67 0.304813 -9 68 1.3369 -9 69 0.65107 -9 70 0.85361 -9 71 0.442513 -9 72 0.143048 -9 73 1.1504 -9 74 2.3643 -9 75 -0.25 -9 76 1.64305 -9 77 -0.165107 -9 78 1.12968 -9 79 0.770722 -9 80 1.40441 -9 81 2.01337 -9 82 1.07219 -9 83 2.625 -9 84 1.92781 -9 85 -0.33623 -9 86 0.339572 -9 87 2.08356 -9 88 2.54746 -9 89 3.73061 -9 90 0.555481 -9 91 -0.921791 -9 92 0.139037 -9 93 1.20187 -9 94 1.74666 -9 95 1.62901 -9 96 1.4893 -9 97 0.989305 -9 98 1.61564 -9 99 0.551471 -9 100 0.595588 -9 101 3.61898 -9 102 2.05949 -9 103 0.502674 -9 104 0.139706 -9 105 2.16778 -9 106 3.03209 -9 107 1.50204 -9 108 1.1686 -10 1 -1.10635 -10 2 -0.392764 -10 3 -0.996955 -10 4 -0.348905 -10 5 0.144938 -10 6 0.838319 -10 7 0.0476026 -10 8 1.00367 -10 9 0.63544 -10 10 -2.21012 -10 11 -0.334757 -10 12 0.330657 -10 13 0.858721 -10 14 -0.183176 -10 15 0.239026 -10 16 1.07828 -10 17 1.55701 -10 18 1.36652 -10 19 1.13466 -10 20 0.158442 -10 21 -0.872471 -10 22 0.51449 -10 23 0.752022 -10 24 1.53894 -10 25 1.22695 -10 26 0.942857 -10 27 0.735911 -10 28 0.629512 -10 29 0.079916 -10 30 2.65015 -10 31 1.57977 -10 32 2.01225 -10 33 -0.0641166 -10 34 1.10854 -10 35 0.251466 -10 36 1.83621 -10 37 1.21241 -10 38 0.0704133 -10 39 -0.966547 -10 40 2.06226 -10 41 -0.97004 -10 42 -1.01543 -10 43 -0.0597997 -10 44 0.465051 -10 45 -0.330552 -10 46 -0.119741 -10 47 -1.08668 -10 48 1.80059 -10 49 2.38141 -10 50 2.25432 -10 51 -1.09272 -10 52 -1.81659 -10 53 1.69504 -10 54 1.44444 -10 55 -2.08273 -10 56 -1.16464 -10 57 -1.96026 -10 58 1.6764 -10 59 0.0235199 -10 60 -0.0348743 -10 61 -0.711273 -10 62 -0.0308191 -10 63 0.282238 -10 64 -5.0811 -10 65 -0.984477 -10 66 0.321895 -10 67 -0.169935 -10 68 -1.00654 -10 69 0.570261 -10 70 -0.0857843 -10 71 -0.102941 -10 72 1.55719 -10 73 1.78676 -10 74 1.72794 -10 75 -1.25 -10 76 1.05719 -10 77 0.754085 -10 78 1.66503 -10 79 -1.23938 -10 80 -0.484477 -10 81 0.558824 -10 82 -0.604575 -10 83 0.291667 -10 84 1.60458 -10 85 1.62337 -10 86 1.46078 -10 87 -1.89624 -10 88 -0.816176 -10 89 -1.13807 -10 90 0.363562 -10 91 1.05801 -10 92 0.189542 -10 93 -0.71732 -10 94 2.33252 -10 95 -3.34069 -10 96 -1.5915 -10 97 0.352941 -10 98 1.76716 -10 99 -1.22631 -10 100 -0.515523 -10 101 -1.59314 -10 102 1.67565 -10 103 3.30065 -10 104 1.91748 -10 105 -1.28676 -10 106 -2.16993 -10 107 1.53234 -10 108 1.7686 ->>END_MODULE ->>Per sequence quality scores pass -#Quality Count -20 7 -21 24 -22 47 -23 78 -24 226 -25 513 -26 830 -27 1017 -28 947 -29 645 -30 352 -31 157 -32 55 -33 6 -34 1 ->>END_MODULE ->>Per base sequence content fail -#Base G A T C -1 21.2232 33.0071 25.9735 19.7961 -2 23.7658 31.4157 27.3154 17.5031 -3 21.8769 28.7058 29.4623 19.955 -4 21.5505 28.2953 28.8505 21.3037 -5 21.2191 30.2059 28.2713 20.3037 -6 22.1243 28.9463 26.3644 22.5651 -7 21.944 29.966 28.3956 19.6944 -8 21.3781 28.8252 27.8622 21.9345 -9 20.078 29.0882 28.655 22.1789 -10-11 21.2432 29.4689 27.6802 21.6076 -12-13 20.8277 29.037 29.1836 20.9517 -14-15 20.24 28.9753 29.4715 21.3132 -16-17 19.8387 29.3964 29.6217 21.1431 -18-19 20.8456 27.8715 29.9731 21.3099 -20-21 20.5382 28.9737 29.1114 21.3767 -22-23 20.8808 30.1295 29.3005 19.6891 -24-25 20.507 29.0773 29.0504 21.3653 -26-27 20.866 28.0549 30.3391 20.7399 -28-29 19.326 30.8425 28.7766 21.0549 -30-31 20.6388 29.1923 29.4994 20.6695 -32-33 19.4799 29.0099 29.3814 22.1289 -34-35 19.6674 29.7132 30.2053 20.4141 -36-37 20.4435 29.854 30.6111 19.0914 -38-39 20.9927 28.0417 30.0888 20.8768 -40-41 19.8602 28.6801 30.3248 21.1349 -42-43 20.0132 27.8732 30.8234 21.2902 -44-45 18.9414 30.1923 29.9549 20.9115 -46-47 20.1889 28.1266 31.4701 20.2144 -48-49 19.5616 29.6892 28.7736 21.9756 -50-51 20.5066 28.2576 30.7598 20.476 -52-53 17.6913 29.918 31.8648 20.526 -54-55 17.2149 32.3099 29.5322 20.943 -56-57 19.3086 30.8937 30.8937 18.904 -58-59 20.0147 29.7277 31.4202 18.8374 -60-61 17.4025 33.1862 29.507 19.9043 -62-63 18.543 29.7277 32.2664 19.4628 -64-65 16.8936 32.9407 30.1803 19.9853 -66-67 18.5199 28.9028 32.8056 19.7717 -68-69 17.268 30.3756 31.6642 20.6922 -70-71 17.673 27.7982 35.3461 19.1826 -72-73 16.2003 29.5287 33.8733 20.3976 -74-75 18.3726 28.0191 34.5361 19.0722 -76-77 16.6789 31.701 31.7378 19.8822 -78-79 18.7776 28.3873 32.6215 20.2135 -80-81 16.3844 30.9278 32.9161 19.7717 -82-83 17.0839 30.9278 32.5479 19.4404 -84-85 16.9367 31.5906 31.4433 20.0295 -86-87 17.489 27.9087 34.2047 20.3976 -88-89 16.7894 32.3638 31.0751 19.7717 -90-91 19.5876 29.7496 33.542 17.1208 -92-93 17.7467 30.0442 31.3328 20.8763 -94-95 18.9249 28.461 33.3947 19.2194 -96-97 16.4212 29.4183 32.4742 21.6863 -98-99 18.1581 29.3438 33.1469 19.3512 -100-101 17.7736 29.8491 33.283 19.0943 -102-103 18.3396 29.5094 30.9057 21.2453 -104-105 18.0377 28.6792 31.7736 21.5094 -106-107 17.2783 29.3578 33.5245 19.8394 -108 20.0535 26.3815 31.7291 21.836 ->>END_MODULE ->>Per sequence GC content warn -#GC Content Count -0 15 -1 15.5 -2 16.5 -3 17 -4 18 -5 21.5 -6 26.5 -7 30 -8 33.5 -9 36 -10 41 -11 47 -12 47.5 -13 56 -14 65.5 -15 69 -16 72.5 -17 77.5 -18 85.5 -19 94.5 -20 105.5 -21 113 -22 120 -23 131.5 -24 150 -25 172.5 -26 198 -27 217.5 -28 244.5 -29 281.5 -30 314.5 -31 337 -32 365 -33 402.5 -34 436 -35 463 -36 481.5 -37 505 -38 525 -39 510.5 -40 490.5 -41 493 -42 487 -43 483.5 -44 488 -45 475.5 -46 468 -47 468.5 -48 477 -49 473 -50 437.5 -51 416 -52 405.5 -53 397 -54 386 -55 365 -56 346 -57 343 -58 334 -59 320 -60 319 -61 301.5 -62 276.5 -63 245.5 -64 207.5 -65 191 -66 182 -67 173 -68 167 -69 151.5 -70 131.5 -71 121 -72 117.5 -73 110.5 -74 104 -75 90.5 -76 75 -77 67.5 -78 62.5 -79 61.5 -80 59 -81 57 -82 55 -83 47 -84 39 -85 38 -86 36.5 -87 35.5 -88 28.5 -89 21 -90 19 -91 17 -92 15.5 -93 14.5 -94 14 -95 13.5 -96 14.5 -97 15.5 -98 15.5 -99 16 -100 15 ->>END_MODULE ->>Per base N content pass -#Base N-Count -1 0 -2 0 -3 0 -4 0 -5 0 -6 0 -7 0 -8 0 -9 0 -10-11 0 -12-13 0 -14-15 0 -16-17 0 -18-19 0 -20-21 0 -22-23 0 -24-25 0 -26-27 0 -28-29 0 -30-31 0 -32-33 0 -34-35 0 -36-37 0 -38-39 0 -40-41 0 -42-43 0 -44-45 0 -46-47 0 -48-49 0 -50-51 0 -52-53 0 -54-55 0 -56-57 0 -58-59 0 -60-61 0 -62-63 0 -64-65 0 -66-67 0 -68-69 0 -70-71 0 -72-73 0 -74-75 0 -76-77 0 -78-79 0 -80-81 0 -82-83 0 -84-85 0 -86-87 0 -88-89 0 -90-91 0 -92-93 0 -94-95 0 -96-97 0 -98-99 0 -100-101 0 -102-103 0 -104-105 0 -106-107 0 -108 0 ->>END_MODULE ->>Sequence Length Distribution warn -#Length Count -1 3.0 -2 11.0 -3 28.0 -4 56.0 -5 43.0 -6 52.0 -7 39.0 -8 56.0 -9 60.0 -10 57.0 -11 43.0 -12 46.0 -13 45.0 -14 66.0 -15 59.0 -16 49.0 -17 73.0 -18 54.0 -19 44.0 -20 52.0 -21 73.0 -22 72.0 -23 68.0 -24 56.0 -25 86.0 -26 92.0 -27 75.0 -28 69.0 -29 74.0 -30 96.0 -31 72.0 -32 81.0 -33 65.0 -34 87.0 -35 86.0 -36 87.0 -37 100.0 -38 82.0 -39 78.0 -40 76.0 -41 79.0 -42 88.0 -43 83.0 -44 75.0 -45 74.0 -46 72.0 -47 84.0 -48 74.0 -49 81.0 -50 91.0 -51 80.0 -52 98.0 -53 43.0 -54 8.0 -55 4.0 -56 1.0 -64 1.0 -97 1.0 -98 32.0 -106 34.0 -107 169.0 -108 1122.0 ->>END_MODULE ->>Sequence Duplication Levels pass -#Total Deduplicated Percentage 98.736 -#Duplication Level Percentage of deduplicated Percentage of total -1 99.4425 98.1855 -2 0.474912 0.937819 -3 0.0412967 0.122324 -4 0.0206484 0.0815494 -5 0 0 -6 0 0 -7 0 0 -8 0 0 -9 0 0 ->10 0.0206484 0.672783 ->50 0 0 ->100 0 0 ->500 0 0 ->1k 0 0 ->5k 0 0 ->10k+ 0 0 ->>END_MODULE ->>Overrepresented sequences warn -#Sequence Count Percentage Possible Source -ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit ->>END_MODULE ->>Adapter Content warn -#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG -1 0 0 0 0 0.0203874 0 -2 0 0 0 0 0.0815494 0 -3 0 0 0 0 0.142712 0 -4 0 0 0 0 0.183486 0 -5 0 0 0 0 0.285423 0 -6 0 0 0 0 0.38736 0 -7 0 0 0 0 0.489297 0 -8 0 0 0 0 0.591233 0 -9 0 0 0 0 0.672783 0 -10 0 0 0 0 0.754332 0 -11 0 0 0 0 0.835882 0 -12 0 0 0 0 0.917431 0 -13 0 0 0 0 1.01937 0 -14 0 0 0 0 1.1213 0 -15 0 0 0 0 1.24363 0 -16 0 0 0 0 1.34557 0 -17 0 0 0 0 1.46789 0 -18 0 0 0 0 1.59021 0 -19 0 0 0 0 1.67176 0 -20 0.122324 0 0 0 1.75331 0 -21 0.122324 0 0 0 1.83486 0 -22 0.122324 0 0 0 1.89602 0 -23 0.122324 0 0 0 1.95719 0 -24 0.122324 0 0 0 2.01835 0 -25 0.122324 0 0 0 2.07951 0 -26 0.122324 0 0 0 2.14067 0 -27 0.142712 0 0 0 2.20183 0 -28 0.183486 0 0 0 2.263 0 -29 0.224261 0 0 0 2.32416 0 -30 0.224261 0 0 0 2.38532 0 -31 0.224261 0 0 0 2.44648 0 -32 0.224261 0 0 0 2.50765 0 -33 0.224261 0 0 0 2.60958 0 -34 0.224261 0 0 0 2.71152 0 -35 0.265036 0 0 0 2.81346 0 -36 0.285423 0 0 0 2.89501 0 -37 0.326198 0 0 0 2.99694 0 -38 0.407747 0 0 0 3.09888 0 -39 0.468909 0 0 0 3.20082 0 -40 0.468909 0 0 0 3.30275 0 -41 0.468909 0 0 0 3.40469 0 -42 0.468909 0 0 0 3.48624 0 -43 0.468909 0 0 0 3.56779 0 -44 0.468909 0 0 0 3.60856 0 -45 0.468909 0 0 0 3.62895 0 -46 0.468909 0 0 0 3.64934 0 -47 0.468909 0 0 0 3.66972 0 -48 0.468909 0 0 0 3.69011 0 -49 0.468909 0 0 0 3.7105 0 -50 0.468909 0 0 0 3.7105 0 -51 0.468909 0 0 0 3.7105 0 -52 0.468909 0 0 0 3.7105 0 -53 0.468909 0 0 0 3.7105 0 -54 0.468909 0 0 0 3.7105 0 -55 0.468909 0 0 0 3.7105 0 -56 0.468909 0 0 0 3.7105 0 -57 0.468909 0 0 0 3.7105 0 -58 0.468909 0 0 0 3.7105 0 -59 0.468909 0 0 0 3.73089 0 -60 0.468909 0 0 0 3.75127 0 -61 0.468909 0 0 0 3.77166 0 -62 0.468909 0 0 0 3.81244 0 -63 0.468909 0 0 0 3.85321 0 -64 0.468909 0 0 0 3.89399 0 -65 0.468909 0 0 0 3.93476 0 -66 0.468909 0 0 0 3.97554 0 -67 0.468909 0 0 0 4.01631 0 -68 0.468909 0 0 0 4.05708 0 -69 0.468909 0 0 0 4.09786 0 -70 0.468909 0 0 0 4.13863 0 -71 0.468909 0 0 0 4.17941 0 -72 0.468909 0 0 0 4.22018 0 -73 0.468909 0 0 0 4.26096 0 -74 0.489297 0 0 0 4.32212 0 -75 0.489297 0 0 0 4.38328 0 -76 0.489297 0 0 0 4.42406 0 -77 0.489297 0 0 0 4.46483 0 -78 0.489297 0 0 0 4.50561 0 -79 0.489297 0 0 0 4.54638 0 -80 0.489297 0 0 0 4.58716 0 -81 0.489297 0 0 0 4.62793 0 -82 0.489297 0 0 0 4.66871 0 -83 0.509684 0 0 0 4.70948 0 -84 0.509684 0 0 0 4.75025 0 -85 0.509684 0 0 0 4.79103 0 -86 0.509684 0 0 0 4.8318 0 -87 0.509684 0 0 0 4.91335 0 -88 0.509684 0 0 0 4.9949 0 -89 0.509684 0 0 0 5.05607 0 -90 0.509684 0 0 0 5.09684 0 -91 0.509684 0 0 0 5.158 0 -92 0.570846 0 0 0 5.21916 0 -93 0.632008 0 0 0 5.28033 0 -94 0.632008 0 0 0 5.34149 0 -95 0.632008 0 0 0 5.40265 0 -96 0.632008 0 0 0 5.46381 0 -97 0.632008 0 0 0 5.52497 0 -98 0.632008 0 0 0 5.52497 0 -99 0.632008 0 0 0 5.52497 0 -100 0.632008 0 0 0 5.52497 0 -101 0.632008 0 0 0 5.52497 0 -102 0.632008 0 0 0 5.52497 0 -103 0.632008 0 0 0 5.52497 0 -104 0.632008 0 0 0 5.52497 0 -105 0.632008 0 0 0 5.52497 0 -106 0.632008 0 0 0 5.52497 0 -107 0.632008 0 0 0 5.52497 0 -108 0.632008 0 0 0 5.52497 0 ->>END_MODULE diff --git a/tools/falco/test-data/fastqc_data_customlimits_summary.txt b/tools/falco/test-data/fastqc_data_customlimits_summary.txt index 109484ffc6f..1d639fa65f6 100644 --- a/tools/falco/test-data/fastqc_data_customlimits_summary.txt +++ b/tools/falco/test-data/fastqc_data_customlimits_summary.txt @@ -1,11 +1,2 @@ PASS Basic Statistics 1000trimmed_fastq -PASS Per base sequence quality 1000trimmed_fastq -FAIL Per tile sequence quality 1000trimmed_fastq -PASS Per sequence quality scores 1000trimmed_fastq -FAIL Per base sequence content 1000trimmed_fastq -WARN Per sequence GC content 1000trimmed_fastq -PASS Per base N content 1000trimmed_fastq WARN Sequence Length Distribution 1000trimmed_fastq -PASS Sequence Duplication Levels 1000trimmed_fastq -WARN Overrepresented sequences 1000trimmed_fastq -PASS Adapter Content 1000trimmed_fastq diff --git a/tools/falco/test-data/fastqc_data_hisat.txt b/tools/falco/test-data/fastqc_data_hisat.txt index fda438ce067..96e52740c79 100644 --- a/tools/falco/test-data/fastqc_data_hisat.txt +++ b/tools/falco/test-data/fastqc_data_hisat.txt @@ -1,448 +1,601 @@ -##FastQC 0.12.1 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename hisat_output_1_bam File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 20 -Total Bases 1.4 kbp Sequences flagged as poor quality 0 Sequence length 70 -%GC 43 +%GC 44 >>END_MODULE ->>Per base sequence quality pass +>>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile -1 17.0 NaN NaN NaN NaN NaN -2 17.0 NaN NaN NaN NaN NaN -3 17.0 NaN NaN NaN NaN NaN -4 17.0 NaN NaN NaN NaN NaN -5 17.0 NaN NaN NaN NaN NaN -6 17.0 NaN NaN NaN NaN NaN -7 17.0 NaN NaN NaN NaN NaN -8 17.0 NaN NaN NaN NaN NaN -9 17.0 NaN NaN NaN NaN NaN -10 17.0 NaN NaN NaN NaN NaN -11 17.0 NaN NaN NaN NaN NaN -12 17.0 NaN NaN NaN NaN NaN -13 17.0 NaN NaN NaN NaN NaN -14 17.0 NaN NaN NaN NaN NaN -15 17.0 NaN NaN NaN NaN NaN -16 17.0 NaN NaN NaN NaN NaN -17 17.0 NaN NaN NaN NaN NaN -18 17.0 NaN NaN NaN NaN NaN -19 17.0 NaN NaN NaN NaN NaN -20 17.0 NaN NaN NaN NaN NaN -21 17.0 NaN NaN NaN NaN NaN -22 17.0 NaN NaN NaN NaN NaN -23 17.0 NaN NaN NaN NaN NaN -24 17.0 NaN NaN NaN NaN NaN -25 17.0 NaN NaN NaN NaN NaN -26 17.0 NaN NaN NaN NaN NaN -27 17.0 NaN NaN NaN NaN NaN -28 17.0 NaN NaN NaN NaN NaN -29 17.0 NaN NaN NaN NaN NaN -30 17.0 NaN NaN NaN NaN NaN -31 17.0 NaN NaN NaN NaN NaN -32 17.0 NaN NaN NaN NaN NaN -33 17.0 NaN NaN NaN NaN NaN -34 17.0 NaN NaN NaN NaN NaN -35 17.0 NaN NaN NaN NaN NaN -36 17.0 NaN NaN NaN NaN NaN -37 17.0 NaN NaN NaN NaN NaN -38 17.0 NaN NaN NaN NaN NaN -39 17.0 NaN NaN NaN NaN NaN -40 17.0 NaN NaN NaN NaN NaN -41 17.0 NaN NaN NaN NaN NaN -42 17.0 NaN NaN NaN NaN NaN -43 17.0 NaN NaN NaN NaN NaN -44 17.0 NaN NaN NaN NaN NaN -45 17.0 NaN NaN NaN NaN NaN -46 17.0 NaN NaN NaN NaN NaN -47 17.0 NaN NaN NaN NaN NaN -48 17.0 NaN NaN NaN NaN NaN -49 17.0 NaN NaN NaN NaN NaN -50 17.0 NaN NaN NaN NaN NaN -51 17.0 NaN NaN NaN NaN NaN -52 17.0 NaN NaN NaN NaN NaN -53 17.0 NaN NaN NaN NaN NaN -54 17.0 NaN NaN NaN NaN NaN -55 17.0 NaN NaN NaN NaN NaN -56 17.0 NaN NaN NaN NaN NaN -57 17.0 NaN NaN NaN NaN NaN -58 17.0 NaN NaN NaN NaN NaN -59 17.0 NaN NaN NaN NaN NaN -60 17.0 NaN NaN NaN NaN NaN -61 17.0 NaN NaN NaN NaN NaN -62 17.0 NaN NaN NaN NaN NaN -63 17.0 NaN NaN NaN NaN NaN -64 17.0 NaN NaN NaN NaN NaN -65 17.0 NaN NaN NaN NaN NaN -66 17.0 NaN NaN NaN NaN NaN -67 17.0 NaN NaN NaN NaN NaN -68 17.0 NaN NaN NaN NaN NaN -69 17.0 NaN NaN NaN NaN NaN -70 17.0 NaN NaN NaN NaN NaN +1 17 17 17 17 17 17 +2 17 17 17 17 17 17 +3 17 17 17 17 17 17 +4 17 17 17 17 17 17 +5 17 17 17 17 17 17 +6 17 17 17 17 17 17 +7 17 17 17 17 17 17 +8 17 17 17 17 17 17 +9 17 17 17 17 17 17 +10 17 17 17 17 17 17 +11 17 17 17 17 17 17 +12 17 17 17 17 17 17 +13 17 17 17 17 17 17 +14 17 17 17 17 17 17 +15 17 17 17 17 17 17 +16 17 17 17 17 17 17 +17 17 17 17 17 17 17 +18 17 17 17 17 17 17 +19 17 17 17 17 17 17 +20 17 17 17 17 17 17 +21 17 17 17 17 17 17 +22 17 17 17 17 17 17 +23 17 17 17 17 17 17 +24 17 17 17 17 17 17 +25 17 17 17 17 17 17 +26 17 17 17 17 17 17 +27 17 17 17 17 17 17 +28 17 17 17 17 17 17 +29 17 17 17 17 17 17 +30 17 17 17 17 17 17 +31 17 17 17 17 17 17 +32 17 17 17 17 17 17 +33 17 17 17 17 17 17 +34 17 17 17 17 17 17 +35 17 17 17 17 17 17 +36 17 17 17 17 17 17 +37 17 17 17 17 17 17 +38 17 17 17 17 17 17 +39 17 17 17 17 17 17 +40 17 17 17 17 17 17 +41 17 17 17 17 17 17 +42 17 17 17 17 17 17 +43 17 17 17 17 17 17 +44 17 17 17 17 17 17 +45 17 17 17 17 17 17 +46 17 17 17 17 17 17 +47 17 17 17 17 17 17 +48 17 17 17 17 17 17 +49 17 17 17 17 17 17 +50 17 17 17 17 17 17 +51 17 17 17 17 17 17 +52 17 17 17 17 17 17 +53 17 17 17 17 17 17 +54 17 17 17 17 17 17 +55 17 17 17 17 17 17 +56 17 17 17 17 17 17 +57 17 17 17 17 17 17 +58 17 17 17 17 17 17 +59 17 17 17 17 17 17 +60 17 17 17 17 17 17 +61 17 17 17 17 17 17 +62 17 17 17 17 17 17 +63 17 17 17 17 17 17 +64 17 17 17 17 17 17 +65 17 17 17 17 17 17 +66 17 17 17 17 17 17 +67 17 17 17 17 17 17 +68 17 17 17 17 17 17 +69 17 17 17 17 17 17 +70 17 17 17 17 17 17 +>>END_MODULE +>>Per tile sequence quality pass +#Tile Base Mean +470 1 0 +470 2 0 +470 3 0 +470 4 0 +470 5 0 +470 6 0 +470 7 0 +470 8 0 +470 9 0 +470 10 0 +470 11 0 +470 12 0 +470 13 0 +470 14 0 +470 15 0 +470 16 0 +470 17 0 +470 18 0 +470 19 0 +470 20 0 +470 21 0 +470 22 0 +470 23 0 +470 24 0 +470 25 0 +470 26 0 +470 27 0 +470 28 0 +470 29 0 +470 30 0 +470 31 0 +470 32 0 +470 33 0 +470 34 0 +470 35 0 +470 36 0 +470 37 0 +470 38 0 +470 39 0 +470 40 0 +470 41 0 +470 42 0 +470 43 0 +470 44 0 +470 45 0 +470 46 0 +470 47 0 +470 48 0 +470 49 0 +470 50 0 +470 51 0 +470 52 0 +470 53 0 +470 54 0 +470 55 0 +470 56 0 +470 57 0 +470 58 0 +470 59 0 +470 60 0 +470 61 0 +470 62 0 +470 63 0 +470 64 0 +470 65 0 +470 66 0 +470 67 0 +470 68 0 +470 69 0 +470 70 0 +473 1 0 +473 2 0 +473 3 0 +473 4 0 +473 5 0 +473 6 0 +473 7 0 +473 8 0 +473 9 0 +473 10 0 +473 11 0 +473 12 0 +473 13 0 +473 14 0 +473 15 0 +473 16 0 +473 17 0 +473 18 0 +473 19 0 +473 20 0 +473 21 0 +473 22 0 +473 23 0 +473 24 0 +473 25 0 +473 26 0 +473 27 0 +473 28 0 +473 29 0 +473 30 0 +473 31 0 +473 32 0 +473 33 0 +473 34 0 +473 35 0 +473 36 0 +473 37 0 +473 38 0 +473 39 0 +473 40 0 +473 41 0 +473 42 0 +473 43 0 +473 44 0 +473 45 0 +473 46 0 +473 47 0 +473 48 0 +473 49 0 +473 50 0 +473 51 0 +473 52 0 +473 53 0 +473 54 0 +473 55 0 +473 56 0 +473 57 0 +473 58 0 +473 59 0 +473 60 0 +473 61 0 +473 62 0 +473 63 0 +473 64 0 +473 65 0 +473 66 0 +473 67 0 +473 68 0 +473 69 0 +473 70 0 >>END_MODULE >>Per sequence quality scores fail #Quality Count -17 20.0 +17 20 >>END_MODULE >>Per base sequence content fail #Base G A T C -1 20.0 5.0 35.0 40.0 -2 10.0 10.0 45.0 35.0 -3 35.0 20.0 20.0 25.0 -4 35.0 30.0 25.0 10.0 -5 20.0 20.0 30.0 30.0 -6 20.0 35.0 20.0 25.0 -7 15.0 40.0 35.0 10.0 -8 20.0 15.0 45.0 20.0 -9 20.0 25.0 35.0 20.0 -10 20.0 20.0 30.0 30.0 -11 15.0 20.0 45.0 20.0 -12 10.0 40.0 35.0 15.0 -13 25.0 35.0 20.0 20.0 -14 35.0 20.0 20.0 25.0 -15 30.0 35.0 15.0 20.0 -16 10.0 45.0 25.0 20.0 -17 25.0 25.0 40.0 10.0 -18 25.0 35.0 10.0 30.0 -19 5.0 30.0 25.0 40.0 -20 20.0 15.0 40.0 25.0 -21 25.0 25.0 25.0 25.0 -22 15.0 30.0 20.0 35.0 -23 20.0 5.0 45.0 30.0 -24 10.0 30.0 35.0 25.0 -25 30.0 40.0 15.0 15.0 -26 15.0 35.0 20.0 30.0 -27 15.0 35.0 30.0 20.0 -28 25.0 25.0 30.0 20.0 -29 15.0 30.0 20.0 35.0 -30 20.0 35.0 30.0 15.0 -31 20.0 35.0 25.0 20.0 -32 35.0 15.0 35.0 15.0 -33 30.0 35.0 15.0 20.0 -34 25.0 25.0 25.0 25.0 -35 25.0 20.0 35.0 20.0 -36 30.0 25.0 20.0 25.0 -37 15.0 45.0 25.0 15.0 -38 30.0 25.0 35.0 10.0 -39 20.0 45.0 15.0 20.0 -40 15.0 35.0 20.0 30.0 -41 35.0 25.0 20.0 20.0 -42 30.0 30.0 35.0 5.0 -43 25.0 15.0 40.0 20.0 -44 40.0 20.0 30.0 10.0 -45 15.0 35.0 25.0 25.0 -46 15.0 30.0 40.0 15.0 -47 35.0 15.0 30.0 20.0 -48 30.0 35.0 20.0 15.0 -49 10.0 55.00000000000001 30.0 5.0 -50 40.0 25.0 20.0 15.0 -51 25.0 35.0 10.0 30.0 -52 30.0 25.0 20.0 25.0 -53 30.0 10.0 30.0 30.0 -54 20.0 40.0 20.0 20.0 -55 10.0 35.0 10.0 45.0 -56 50.0 10.0 30.0 10.0 -57 15.0 45.0 30.0 10.0 -58 20.0 35.0 20.0 25.0 -59 30.0 35.0 30.0 5.0 -60 20.0 35.0 25.0 20.0 -61 25.0 15.0 35.0 25.0 -62 10.0 20.0 55.00000000000001 15.0 -63 25.0 20.0 35.0 20.0 -64 20.0 35.0 25.0 20.0 -65 30.0 35.0 25.0 10.0 -66 15.0 40.0 35.0 10.0 -67 20.0 35.0 20.0 25.0 -68 20.0 25.0 30.0 25.0 -69 15.0 35.0 25.0 25.0 -70 5.0 40.0 40.0 15.0 +1 20 5 35 40 +2 10 10 45 35 +3 35 20 20 25 +4 35 30 25 10 +5 20 20 30 30 +6 20 35 20 25 +7 15 40 35 10 +8 20 15 45 20 +9 20 25 35 20 +10 20 20 30 30 +11 15 20 45 20 +12 10 40 35 15 +13 25 35 20 20 +14 35 20 20 25 +15 30 35 15 20 +16 10 45 25 20 +17 25 25 40 10 +18 25 35 10 30 +19 5 30 25 40 +20 20 15 40 25 +21 25 25 25 25 +22 15 30 20 35 +23 20 5 45 30 +24 10 30 35 25 +25 30 40 15 15 +26 15 35 20 30 +27 15 35 30 20 +28 25 25 30 20 +29 15 30 20 35 +30 20 35 30 15 +31 20 35 25 20 +32 35 15 35 15 +33 30 35 15 20 +34 25 25 25 25 +35 25 20 35 20 +36 30 25 20 25 +37 15 45 25 15 +38 30 25 35 10 +39 20 45 15 20 +40 15 35 20 30 +41 35 25 20 20 +42 30 30 35 5 +43 25 15 40 20 +44 40 20 30 10 +45 15 35 25 25 +46 15 30 40 15 +47 35 15 30 20 +48 30 35 20 15 +49 10 55 30 5 +50 40 25 20 15 +51 25 35 10 30 +52 30 25 20 25 +53 30 10 30 30 +54 20 40 20 20 +55 10 35 10 45 +56 50 10 30 10 +57 15 45 30 10 +58 20 35 20 25 +59 30 35 30 5 +60 20 35 25 20 +61 25 15 35 25 +62 10 20 55 15 +63 25 20 35 20 +64 20 35 25 20 +65 30 35 25 10 +66 15 40 35 10 +67 20 35 20 25 +68 20 25 30 25 +69 15 35 25 25 +70 5 40 40 15 >>END_MODULE >>Per sequence GC content fail #GC Content Count -0 0.0 -1 0.0 -2 0.0 -3 0.0 -4 0.0 -5 0.0 -6 0.0 -7 0.0 -8 0.0 -9 0.0 -10 0.0 -11 0.0 -12 0.0 -13 0.0 -14 0.0 -15 0.0 -16 0.0 -17 0.0 -18 0.0 -19 0.0 -20 0.0 -21 0.0 -22 0.0 -23 0.0 -24 0.0 -25 0.0 -26 0.0 -27 0.0 -28 0.0 +0 0 +1 0 +2 0 +3 0 +4 0 +5 0 +6 0 +7 0 +8 0 +9 0 +10 0 +11 0 +12 0 +13 0 +14 0 +15 0 +16 0 +17 0 +18 0 +19 0 +20 0 +21 0 +22 0 +23 0 +24 0 +25 0 +26 0 +27 0 +28 0 29 0.5 -30 1.0 +30 1 31 0.5 32 0.5 -33 1.0 +33 1 34 0.5 -35 0.0 -36 0.0 -37 0.0 -38 1.0 +35 0 +36 0 +37 0 +38 1 39 2.5 -40 3.0 -41 2.0 +40 3 +41 2 42 1.5 -43 2.0 +43 2 44 2.5 45 2.5 -46 1.0 -47 0.0 +46 1 +47 0 48 0.5 49 0.5 -50 0.0 +50 0 51 1.5 52 1.5 -53 0.0 +53 0 54 0.5 55 0.5 -56 0.0 -57 0.0 -58 0.0 -59 0.0 -60 0.0 -61 0.0 -62 0.0 -63 0.0 -64 0.0 -65 0.0 -66 0.0 -67 0.0 -68 0.0 -69 0.0 -70 0.0 -71 0.0 -72 0.0 -73 0.0 -74 0.0 -75 0.0 -76 0.0 -77 0.0 -78 0.0 -79 0.0 -80 0.0 -81 0.0 -82 0.0 -83 0.0 -84 0.0 -85 0.0 -86 0.0 -87 0.0 -88 0.0 -89 0.0 -90 0.0 -91 0.0 -92 0.0 -93 0.0 -94 0.0 -95 0.0 -96 0.0 -97 0.0 -98 0.0 -99 0.0 -100 0.0 +56 0 +57 0 +58 0 +59 0 +60 0 +61 0 +62 0 +63 0 +64 0 +65 0 +66 0 +67 0 +68 0 +69 0 +70 0 +71 0 +72 0 +73 0 +74 0 +75 0 +76 0 +77 0 +78 0 +79 0 +80 0 +81 0 +82 0 +83 0 +84 0 +85 0 +86 0 +87 0 +88 0 +89 0 +90 0 +91 0 +92 0 +93 0 +94 0 +95 0 +96 0 +97 0 +98 0 +99 0 +100 0 >>END_MODULE >>Per base N content pass #Base N-Count -1 0.0 -2 0.0 -3 0.0 -4 0.0 -5 0.0 -6 0.0 -7 0.0 -8 0.0 -9 0.0 -10 0.0 -11 0.0 -12 0.0 -13 0.0 -14 0.0 -15 0.0 -16 0.0 -17 0.0 -18 0.0 -19 0.0 -20 0.0 -21 0.0 -22 0.0 -23 0.0 -24 0.0 -25 0.0 -26 0.0 -27 0.0 -28 0.0 -29 0.0 -30 0.0 -31 0.0 -32 0.0 -33 0.0 -34 0.0 -35 0.0 -36 0.0 -37 0.0 -38 0.0 -39 0.0 -40 0.0 -41 0.0 -42 0.0 -43 0.0 -44 0.0 -45 0.0 -46 0.0 -47 0.0 -48 0.0 -49 0.0 -50 0.0 -51 0.0 -52 0.0 -53 0.0 -54 0.0 -55 0.0 -56 0.0 -57 0.0 -58 0.0 -59 0.0 -60 0.0 -61 0.0 -62 0.0 -63 0.0 -64 0.0 -65 0.0 -66 0.0 -67 0.0 -68 0.0 -69 0.0 -70 0.0 +1 0 +2 0 +3 0 +4 0 +5 0 +6 0 +7 0 +8 0 +9 0 +10 0 +11 0 +12 0 +13 0 +14 0 +15 0 +16 0 +17 0 +18 0 +19 0 +20 0 +21 0 +22 0 +23 0 +24 0 +25 0 +26 0 +27 0 +28 0 +29 0 +30 0 +31 0 +32 0 +33 0 +34 0 +35 0 +36 0 +37 0 +38 0 +39 0 +40 0 +41 0 +42 0 +43 0 +44 0 +45 0 +46 0 +47 0 +48 0 +49 0 +50 0 +51 0 +52 0 +53 0 +54 0 +55 0 +56 0 +57 0 +58 0 +59 0 +60 0 +61 0 +62 0 +63 0 +64 0 +65 0 +66 0 +67 0 +68 0 +69 0 +70 0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 20.0 >>END_MODULE >>Sequence Duplication Levels pass -#Total Deduplicated Percentage 100.0 -#Duplication Level Percentage of total -1 100.0 -2 0.0 -3 0.0 -4 0.0 -5 0.0 -6 0.0 -7 0.0 -8 0.0 -9 0.0 ->10 0.0 ->50 0.0 ->100 0.0 ->500 0.0 ->1k 0.0 ->5k 0.0 ->10k+ 0.0 +#Total Deduplicated Percentage 100 +#Duplication Level Percentage of deduplicated Percentage of total +1 100 100 +2 0 0 +3 0 0 +4 0 0 +5 0 0 +6 0 0 +7 0 0 +8 0 0 +9 0 0 +>10 0 0 +>50 0 0 +>100 0 0 +>500 0 0 +>1k 0 0 +>5k 0 0 +>10k+ 0 0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source -CCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAG 1 5.0 No Hit -TGGCGCTCTCCGTCTTTCTCCATTTCGTCGTGGCCTTGCTATTGACTCTA 1 5.0 No Hit -ACCATAAACGCAAGCCTCAACGCAGCGACGAGCACGAGAGCGGTCAGTAG 1 5.0 No Hit -TGTTTTCCGTAAATTCAGCGCCTTCCATGATGCGACAGGCCGTTTGAATG 1 5.0 No Hit -CTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGT 1 5.0 No Hit -TCTGCGTTTGCTGATGAACTAAGTCAACCTCAGCACTAACCTTGCGAGTC 1 5.0 No Hit -CCATACAAAACAGGGTCGCCAGCAATATCGGTATAAGTCAAAGCACCTTT 1 5.0 No Hit -TAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTCAAG 1 5.0 No Hit -CAAATTAGCATAAGCAGCTTGCAGACCCATAATGTCAATAGATGTGGTAG 1 5.0 No Hit -GCGTTAAGGTACTGAATCTCTTTAGTCGCAGTAGGCGGAAAACGAACAAG 1 5.0 No Hit -CTGAATGGAATTAAGAAAACCACCAATACCAGCATTAACCTTCAAACTAT 1 5.0 No Hit -GCGACCATTCAAAGGATAAACATCATAGGCAGTCGGGAGGGTAGTCGGAA 1 5.0 No Hit -GTGAAATTTCTAGGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAG 1 5.0 No Hit -CTCAAATCCGGCGTCAACCATACCAGCATAGGAAGCATCAGCACCAGCAC 1 5.0 No Hit -TTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACC 1 5.0 No Hit -CTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATA 1 5.0 No Hit -TTAGGTGTGTGTAAAACAGGTGCCGAAGAAGCTGGATTAACAGAATTGAG 1 5.0 No Hit -GCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGA 1 5.0 No Hit -TTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGTAATT 1 5.0 No Hit -CTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAA 1 5.0 No Hit +ACCATAAACGCAAGCCTCAACGCAGCGACGAGCACGAGAGCGGTCAGTAGCAATCCAAACTTTGTTACTC 1 5 No Hit +GTGAAATTTCTAGGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCA 1 5 No Hit +CCATACAAAACAGGGTCGCCAGCAATATCGGTATAAGTCAAAGCACCTTTAGCGTTAAGGTACTGAATCT 1 5 No Hit +CTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCA 1 5 No Hit +CAAATTAGCATAAGCAGCTTGCAGACCCATAATGTCAATAGATGTGGTAGAAGTCGTCATTTGGCTAGAA 1 5 No Hit +CTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAAAT 1 5 No Hit +TGGCGCTCTCCGTCTTTCTCCATTTCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTT 1 5 No Hit +TAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTCAAGCGCCGAGGATGCGTGACCGT 1 5 No Hit +TGTTTTCCGTAAATTCAGCGCCTTCCATGATGCGACAGGCCGTTTGAATGTTGACGGGATGAACATAATA 1 5 No Hit +TTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAG 1 5 No Hit +TCTGCGTTTGCTGATGAACTAAGTCAACCTCAGCACTAACCTTGCGAGTCATTTCATTGATTTGGTCATT 1 5 No Hit +GCGTTAAGGTACTGAATCTCTTTAGTCGCAGTAGGCGGAAAACGAACAAGCGCAAGAGTAAACATAGTGC 1 5 No Hit +CCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCT 1 5 No Hit +TTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGTAATTACTACTGCTTGTTTACGAAT 1 5 No Hit +TTAGGTGTGTGTAAAACAGGTGCCGAAGAAGCTGGATTAACAGAATTGAGAACCAGCTTATCAGAAAAAA 1 5 No Hit +CTGAATGGAATTAAGAAAACCACCAATACCAGCATTAACCTTCAAACTATCAAAATATAACGTTGACGAT 1 5 No Hit +GCGACCATTCAAAGGATAAACATCATAGGCAGTCGGGAGGGTAGTCGGAACCGACGAAGACTCAAAGCGA 1 5 No Hit +GCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCCGCCTC 1 5 No Hit +CTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAA 1 5 No Hit +CTCAAATCCGGCGTCAACCATACCAGCATAGGAAGCATCAGCACCAGCACGCTCCCAAGCATTAATCTCA 1 5 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG -1 0.0 0.0 0.0 0.0 0.0 0.0 -2 0.0 0.0 0.0 0.0 0.0 0.0 -3 0.0 0.0 0.0 0.0 0.0 0.0 -4 0.0 0.0 0.0 0.0 0.0 0.0 -5 0.0 0.0 0.0 0.0 0.0 0.0 -6 0.0 0.0 0.0 0.0 0.0 0.0 -7 0.0 0.0 0.0 0.0 0.0 0.0 -8 0.0 0.0 0.0 0.0 0.0 0.0 -9 0.0 0.0 0.0 0.0 0.0 0.0 -10 0.0 0.0 0.0 0.0 0.0 0.0 -11 0.0 0.0 0.0 0.0 0.0 0.0 -12 0.0 0.0 0.0 0.0 0.0 0.0 -13 0.0 0.0 0.0 0.0 0.0 0.0 -14 0.0 0.0 0.0 0.0 0.0 0.0 -15 0.0 0.0 0.0 0.0 0.0 0.0 -16 0.0 0.0 0.0 0.0 0.0 0.0 -17 0.0 0.0 0.0 0.0 0.0 0.0 -18 0.0 0.0 0.0 0.0 0.0 0.0 -19 0.0 0.0 0.0 0.0 0.0 0.0 -20 0.0 0.0 0.0 0.0 0.0 0.0 -21 0.0 0.0 0.0 0.0 0.0 0.0 -22 0.0 0.0 0.0 0.0 0.0 0.0 -23 0.0 0.0 0.0 0.0 0.0 0.0 -24 0.0 0.0 0.0 0.0 0.0 0.0 -25 0.0 0.0 0.0 0.0 0.0 0.0 -26 0.0 0.0 0.0 0.0 0.0 0.0 -27 0.0 0.0 0.0 0.0 0.0 0.0 -28 0.0 0.0 0.0 0.0 0.0 0.0 -29 0.0 0.0 0.0 0.0 0.0 0.0 -30 0.0 0.0 0.0 0.0 0.0 0.0 -31 0.0 0.0 0.0 0.0 0.0 0.0 -32 0.0 0.0 0.0 0.0 0.0 0.0 -33 0.0 0.0 0.0 0.0 0.0 0.0 -34 0.0 0.0 0.0 0.0 0.0 0.0 -35 0.0 0.0 0.0 0.0 0.0 0.0 -36 0.0 0.0 0.0 0.0 0.0 0.0 -37 0.0 0.0 0.0 0.0 0.0 0.0 -38 0.0 0.0 0.0 0.0 0.0 0.0 -39 0.0 0.0 0.0 0.0 0.0 0.0 -40 0.0 0.0 0.0 0.0 0.0 0.0 -41 0.0 0.0 0.0 0.0 0.0 0.0 -42 0.0 0.0 0.0 0.0 0.0 0.0 -43 0.0 0.0 0.0 0.0 0.0 0.0 -44 0.0 0.0 0.0 0.0 0.0 0.0 -45 0.0 0.0 0.0 0.0 0.0 0.0 -46 0.0 0.0 0.0 0.0 0.0 0.0 -47 0.0 0.0 0.0 0.0 0.0 0.0 -48 0.0 0.0 0.0 0.0 0.0 0.0 -49 0.0 0.0 0.0 0.0 0.0 0.0 -50 0.0 0.0 0.0 0.0 0.0 0.0 -51 0.0 0.0 0.0 0.0 0.0 0.0 -52 0.0 0.0 0.0 0.0 0.0 0.0 -53 0.0 0.0 0.0 0.0 0.0 0.0 -54 0.0 0.0 0.0 0.0 0.0 0.0 -55 0.0 0.0 0.0 0.0 0.0 0.0 -56 0.0 0.0 0.0 0.0 0.0 0.0 -57 0.0 0.0 0.0 0.0 0.0 0.0 -58 0.0 0.0 0.0 0.0 0.0 0.0 -59 0.0 0.0 0.0 0.0 0.0 0.0 +1 0 0 0 0 0 0 +2 0 0 0 0 0 0 +3 0 0 0 0 0 0 +4 0 0 0 0 0 0 +5 0 0 0 0 0 0 +6 0 0 0 0 0 0 +7 0 0 0 0 0 0 +8 0 0 0 0 0 0 +9 0 0 0 0 0 0 +10 0 0 0 0 0 0 +11 0 0 0 0 0 0 +12 0 0 0 0 0 0 +13 0 0 0 0 0 0 +14 0 0 0 0 0 0 +15 0 0 0 0 0 0 +16 0 0 0 0 0 0 +17 0 0 0 0 0 0 +18 0 0 0 0 0 0 +19 0 0 0 0 0 0 +20 0 0 0 0 0 0 +21 0 0 0 0 0 0 +22 0 0 0 0 0 0 +23 0 0 0 0 0 0 +24 0 0 0 0 0 0 +25 0 0 0 0 0 0 +26 0 0 0 0 0 0 +27 0 0 0 0 0 0 +28 0 0 0 0 0 0 +29 0 0 0 0 0 0 +30 0 0 0 0 0 0 +31 0 0 0 0 0 0 +32 0 0 0 0 0 0 +33 0 0 0 0 0 0 +34 0 0 0 0 0 0 +35 0 0 0 0 0 0 +36 0 0 0 0 0 0 +37 0 0 0 0 0 0 +38 0 0 0 0 0 0 +39 0 0 0 0 0 0 +40 0 0 0 0 0 0 +41 0 0 0 0 0 0 +42 0 0 0 0 0 0 +43 0 0 0 0 0 0 +44 0 0 0 0 0 0 +45 0 0 0 0 0 0 +46 0 0 0 0 0 0 +47 0 0 0 0 0 0 +48 0 0 0 0 0 0 +49 0 0 0 0 0 0 +50 0 0 0 0 0 0 +51 0 0 0 0 0 0 +52 0 0 0 0 0 0 +53 0 0 0 0 0 0 +54 0 0 0 0 0 0 +55 0 0 0 0 0 0 +56 0 0 0 0 0 0 +57 0 0 0 0 0 0 +58 0 0 0 0 0 0 +59 0 0 0 0 0 0 +60 0 0 0 0 0 0 +61 0 0 0 0 0 0 +62 0 0 0 0 0 0 +63 0 0 0 0 0 0 +64 0 0 0 0 0 0 +65 0 0 0 0 0 0 +66 0 0 0 0 0 0 +67 0 0 0 0 0 0 +68 0 0 0 0 0 0 +69 0 0 0 0 0 0 +70 0 0 0 0 0 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_data_nogroup.txt b/tools/falco/test-data/fastqc_data_nogroup.txt index 842ada09b78..18ffb98f34e 100644 --- a/tools/falco/test-data/fastqc_data_nogroup.txt +++ b/tools/falco/test-data/fastqc_data_nogroup.txt @@ -1,4 +1,4 @@ -##Falco 1.2.3 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1744,114 +1744,114 @@ Sequence length 1-108 #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content warn +>>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG 1 0 0 0 0 0.0203874 0 -2 0 0 0 0 0.0815494 0 -3 0 0 0 0 0.142712 0 -4 0 0 0 0 0.183486 0 -5 0 0 0 0 0.285423 0 -6 0 0 0 0 0.38736 0 -7 0 0 0 0 0.489297 0 -8 0 0 0 0 0.591233 0 -9 0 0 0 0 0.672783 0 -10 0 0 0 0 0.754332 0 -11 0 0 0 0 0.835882 0 -12 0 0 0 0 0.917431 0 -13 0 0 0 0 1.01937 0 -14 0 0 0 0 1.1213 0 -15 0 0 0 0 1.24363 0 -16 0 0 0 0 1.34557 0 -17 0 0 0 0 1.46789 0 -18 0 0 0 0 1.59021 0 -19 0 0 0 0 1.67176 0 -20 0.122324 0 0 0 1.75331 0 -21 0.122324 0 0 0 1.83486 0 -22 0.122324 0 0 0 1.89602 0 -23 0.122324 0 0 0 1.95719 0 -24 0.122324 0 0 0 2.01835 0 -25 0.122324 0 0 0 2.07951 0 -26 0.122324 0 0 0 2.14067 0 -27 0.142712 0 0 0 2.20183 0 -28 0.183486 0 0 0 2.263 0 -29 0.224261 0 0 0 2.32416 0 -30 0.224261 0 0 0 2.38532 0 -31 0.224261 0 0 0 2.44648 0 -32 0.224261 0 0 0 2.50765 0 -33 0.224261 0 0 0 2.60958 0 -34 0.224261 0 0 0 2.71152 0 -35 0.265036 0 0 0 2.81346 0 -36 0.285423 0 0 0 2.89501 0 -37 0.326198 0 0 0 2.99694 0 -38 0.407747 0 0 0 3.09888 0 -39 0.468909 0 0 0 3.20082 0 -40 0.468909 0 0 0 3.30275 0 -41 0.468909 0 0 0 3.40469 0 -42 0.468909 0 0 0 3.48624 0 -43 0.468909 0 0 0 3.56779 0 -44 0.468909 0 0 0 3.60856 0 -45 0.468909 0 0 0 3.62895 0 -46 0.468909 0 0 0 3.64934 0 -47 0.468909 0 0 0 3.66972 0 -48 0.468909 0 0 0 3.69011 0 -49 0.468909 0 0 0 3.7105 0 -50 0.468909 0 0 0 3.7105 0 -51 0.468909 0 0 0 3.7105 0 -52 0.468909 0 0 0 3.7105 0 -53 0.468909 0 0 0 3.7105 0 -54 0.468909 0 0 0 3.7105 0 -55 0.468909 0 0 0 3.7105 0 -56 0.468909 0 0 0 3.7105 0 -57 0.468909 0 0 0 3.7105 0 -58 0.468909 0 0 0 3.7105 0 -59 0.468909 0 0 0 3.73089 0 -60 0.468909 0 0 0 3.75127 0 -61 0.468909 0 0 0 3.77166 0 -62 0.468909 0 0 0 3.81244 0 -63 0.468909 0 0 0 3.85321 0 -64 0.468909 0 0 0 3.89399 0 -65 0.468909 0 0 0 3.93476 0 -66 0.468909 0 0 0 3.97554 0 -67 0.468909 0 0 0 4.01631 0 -68 0.468909 0 0 0 4.05708 0 -69 0.468909 0 0 0 4.09786 0 -70 0.468909 0 0 0 4.13863 0 -71 0.468909 0 0 0 4.17941 0 -72 0.468909 0 0 0 4.22018 0 -73 0.468909 0 0 0 4.26096 0 -74 0.489297 0 0 0 4.32212 0 -75 0.489297 0 0 0 4.38328 0 -76 0.489297 0 0 0 4.42406 0 -77 0.489297 0 0 0 4.46483 0 -78 0.489297 0 0 0 4.50561 0 -79 0.489297 0 0 0 4.54638 0 -80 0.489297 0 0 0 4.58716 0 -81 0.489297 0 0 0 4.62793 0 -82 0.489297 0 0 0 4.66871 0 -83 0.509684 0 0 0 4.70948 0 -84 0.509684 0 0 0 4.75025 0 -85 0.509684 0 0 0 4.79103 0 -86 0.509684 0 0 0 4.8318 0 -87 0.509684 0 0 0 4.91335 0 -88 0.509684 0 0 0 4.9949 0 -89 0.509684 0 0 0 5.05607 0 -90 0.509684 0 0 0 5.09684 0 -91 0.509684 0 0 0 5.158 0 -92 0.570846 0 0 0 5.21916 0 -93 0.632008 0 0 0 5.28033 0 -94 0.632008 0 0 0 5.34149 0 -95 0.632008 0 0 0 5.40265 0 -96 0.632008 0 0 0 5.46381 0 -97 0.632008 0 0 0 5.52497 0 -98 0.632008 0 0 0 5.52497 0 -99 0.632008 0 0 0 5.52497 0 -100 0.632008 0 0 0 5.52497 0 -101 0.632008 0 0 0 5.52497 0 -102 0.632008 0 0 0 5.52497 0 -103 0.632008 0 0 0 5.52497 0 -104 0.632008 0 0 0 5.52497 0 -105 0.632008 0 0 0 5.52497 0 -106 0.632008 0 0 0 5.52497 0 -107 0.632008 0 0 0 5.52497 0 -108 0.632008 0 0 0 5.52497 0 +2 0 0 0 0 0.0611621 0 +3 0 0 0 0 0.0611621 0 +4 0 0 0 0 0.0611621 0 +5 0 0 0 0 0.122324 0 +6 0 0 0 0 0.122324 0 +7 0 0 0 0 0.122324 0 +8 0 0 0 0 0.142712 0 +9 0 0 0 0 0.142712 0 +10 0 0 0 0 0.142712 0 +11 0 0 0 0 0.142712 0 +12 0 0 0 0 0.142712 0 +13 0 0 0 0 0.163099 0 +14 0 0 0 0 0.163099 0 +15 0 0 0 0 0.183486 0 +16 0 0 0 0 0.203874 0 +17 0 0 0 0 0.224261 0 +18 0 0 0 0 0.224261 0 +19 0 0 0 0 0.224261 0 +20 0.122324 0 0 0 0.244648 0 +21 0.122324 0 0 0 0.244648 0 +22 0.122324 0 0 0 0.244648 0 +23 0.122324 0 0 0 0.244648 0 +24 0.122324 0 0 0 0.244648 0 +25 0.122324 0 0 0 0.244648 0 +26 0.122324 0 0 0 0.244648 0 +27 0.142712 0 0 0 0.244648 0 +28 0.183486 0 0 0 0.244648 0 +29 0.224261 0 0 0 0.244648 0 +30 0.224261 0 0 0 0.244648 0 +31 0.224261 0 0 0 0.244648 0 +32 0.224261 0 0 0 0.244648 0 +33 0.224261 0 0 0 0.285423 0 +34 0.224261 0 0 0 0.285423 0 +35 0.265036 0 0 0 0.30581 0 +36 0.285423 0 0 0 0.30581 0 +37 0.326198 0 0 0 0.326198 0 +38 0.407747 0 0 0 0.326198 0 +39 0.468909 0 0 0 0.326198 0 +40 0.468909 0 0 0 0.326198 0 +41 0.468909 0 0 0 0.326198 0 +42 0.468909 0 0 0 0.326198 0 +43 0.468909 0 0 0 0.326198 0 +44 0.468909 0 0 0 0.326198 0 +45 0.468909 0 0 0 0.326198 0 +46 0.468909 0 0 0 0.326198 0 +47 0.468909 0 0 0 0.326198 0 +48 0.468909 0 0 0 0.326198 0 +49 0.468909 0 0 0 0.326198 0 +50 0.468909 0 0 0 0.326198 0 +51 0.468909 0 0 0 0.326198 0 +52 0.468909 0 0 0 0.326198 0 +53 0.468909 0 0 0 0.326198 0 +54 0.468909 0 0 0 0.326198 0 +55 0.468909 0 0 0 0.326198 0 +56 0.468909 0 0 0 0.326198 0 +57 0.468909 0 0 0 0.326198 0 +58 0.468909 0 0 0 0.326198 0 +59 0.468909 0 0 0 0.326198 0 +60 0.468909 0 0 0 0.326198 0 +61 0.468909 0 0 0 0.326198 0 +62 0.468909 0 0 0 0.326198 0 +63 0.468909 0 0 0 0.326198 0 +64 0.468909 0 0 0 0.326198 0 +65 0.468909 0 0 0 0.326198 0 +66 0.468909 0 0 0 0.326198 0 +67 0.468909 0 0 0 0.326198 0 +68 0.468909 0 0 0 0.326198 0 +69 0.468909 0 0 0 0.326198 0 +70 0.468909 0 0 0 0.326198 0 +71 0.468909 0 0 0 0.326198 0 +72 0.468909 0 0 0 0.326198 0 +73 0.468909 0 0 0 0.326198 0 +74 0.468909 0 0 0 0.326198 0 +75 0.468909 0 0 0 0.326198 0 +76 0.468909 0 0 0 0.326198 0 +77 0.468909 0 0 0 0.326198 0 +78 0.468909 0 0 0 0.326198 0 +79 0.468909 0 0 0 0.326198 0 +80 0.468909 0 0 0 0.326198 0 +81 0.468909 0 0 0 0.326198 0 +82 0.468909 0 0 0 0.326198 0 +83 0.468909 0 0 0 0.326198 0 +84 0.468909 0 0 0 0.326198 0 +85 0.468909 0 0 0 0.326198 0 +86 0.468909 0 0 0 0.326198 0 +87 0.468909 0 0 0 0.326198 0 +88 0.468909 0 0 0 0.326198 0 +89 0.468909 0 0 0 0.326198 0 +90 0.468909 0 0 0 0.326198 0 +91 0.468909 0 0 0 0.326198 0 +92 0.468909 0 0 0 0.326198 0 +93 0.468909 0 0 0 0.326198 0 +94 0.468909 0 0 0 0.326198 0 +95 0.468909 0 0 0 0.326198 0 +96 0.468909 0 0 0 0.326198 0 +97 0.468909 0 0 0 0.326198 0 +98 0.468909 0 0 0 0.326198 0 +99 0.468909 0 0 0 0.326198 0 +100 0.468909 0 0 0 0.326198 0 +101 0.468909 0 0 0 0.326198 0 +102 0.468909 0 0 0 0.326198 0 +103 0.468909 0 0 0 0.326198 0 +104 0.468909 0 0 0 0.326198 0 +105 0.468909 0 0 0 0.326198 0 +106 0.468909 0 0 0 0.326198 0 +107 0.468909 0 0 0 0.326198 0 +108 0.468909 0 0 0 0.326198 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_data_nogroup_summary.txt b/tools/falco/test-data/fastqc_data_nogroup_summary.txt deleted file mode 100644 index 7e94fefb156..00000000000 --- a/tools/falco/test-data/fastqc_data_nogroup_summary.txt +++ /dev/null @@ -1,11 +0,0 @@ -PASS Basic Statistics 1000trimmed_fastq -PASS Per base sequence quality 1000trimmed_fastq -FAIL Per tile sequence quality 1000trimmed_fastq -PASS Per sequence quality scores 1000trimmed_fastq -FAIL Per base sequence content 1000trimmed_fastq -WARN Per sequence GC content 1000trimmed_fastq -PASS Per base N content 1000trimmed_fastq -WARN Sequence Length Distribution 1000trimmed_fastq -PASS Sequence Duplication Levels 1000trimmed_fastq -WARN Overrepresented sequences 1000trimmed_fastq -WARN Adapter Content 1000trimmed_fastq diff --git a/tools/falco/test-data/fastqc_data_adapters_summary.txt b/tools/falco/test-data/fastqc_data_summary.txt similarity index 100% rename from tools/falco/test-data/fastqc_data_adapters_summary.txt rename to tools/falco/test-data/fastqc_data_summary.txt diff --git a/tools/falco/test-data/fastqc_report.html b/tools/falco/test-data/fastqc_report.html deleted file mode 100644 index 611aa925db4..00000000000 --- a/tools/falco/test-data/fastqc_report.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:39:03 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : warn

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_adapters.html b/tools/falco/test-data/fastqc_report_adapters.html deleted file mode 100644 index 183af248509..00000000000 --- a/tools/falco/test-data/fastqc_report_adapters.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:39:42 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : pass

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_bisulfite.html b/tools/falco/test-data/fastqc_report_bisulfite.html deleted file mode 100644 index bab408df38a..00000000000 --- a/tools/falco/test-data/fastqc_report_bisulfite.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:40:53 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : warn

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : warn

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_bisulfite.txt b/tools/falco/test-data/fastqc_report_bisulfite.txt index f8d32038dd3..6b767d2c476 100644 --- a/tools/falco/test-data/fastqc_report_bisulfite.txt +++ b/tools/falco/test-data/fastqc_report_bisulfite.txt @@ -1,4 +1,4 @@ -##Falco 1.2.3 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ Sequence length 1-108 #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content warn +>>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG 1 0 0 0 0 0.0203874 0 -2 0 0 0 0 0.0815494 0 -3 0 0 0 0 0.142712 0 -4 0 0 0 0 0.183486 0 -5 0 0 0 0 0.285423 0 -6 0 0 0 0 0.38736 0 -7 0 0 0 0 0.489297 0 -8 0 0 0 0 0.591233 0 -9 0 0 0 0 0.672783 0 -10 0 0 0 0 0.754332 0 -11 0 0 0 0 0.835882 0 -12 0 0 0 0 0.917431 0 -13 0 0 0 0 1.01937 0 -14 0 0 0 0 1.1213 0 -15 0 0 0 0 1.24363 0 -16 0 0 0 0 1.34557 0 -17 0 0 0 0 1.46789 0 -18 0 0 0 0 1.59021 0 -19 0 0 0 0 1.67176 0 -20 0.122324 0 0 0 1.75331 0 -21 0.122324 0 0 0 1.83486 0 -22 0.122324 0 0 0 1.89602 0 -23 0.122324 0 0 0 1.95719 0 -24 0.122324 0 0 0 2.01835 0 -25 0.122324 0 0 0 2.07951 0 -26 0.122324 0 0 0 2.14067 0 -27 0.142712 0 0 0 2.20183 0 -28 0.183486 0 0 0 2.263 0 -29 0.224261 0 0 0 2.32416 0 -30 0.224261 0 0 0 2.38532 0 -31 0.224261 0 0 0 2.44648 0 -32 0.224261 0 0 0 2.50765 0 -33 0.224261 0 0 0 2.60958 0 -34 0.224261 0 0 0 2.71152 0 -35 0.265036 0 0 0 2.81346 0 -36 0.285423 0 0 0 2.89501 0 -37 0.326198 0 0 0 2.99694 0 -38 0.407747 0 0 0 3.09888 0 -39 0.468909 0 0 0 3.20082 0 -40 0.468909 0 0 0 3.30275 0 -41 0.468909 0 0 0 3.40469 0 -42 0.468909 0 0 0 3.48624 0 -43 0.468909 0 0 0 3.56779 0 -44 0.468909 0 0 0 3.60856 0 -45 0.468909 0 0 0 3.62895 0 -46 0.468909 0 0 0 3.64934 0 -47 0.468909 0 0 0 3.66972 0 -48 0.468909 0 0 0 3.69011 0 -49 0.468909 0 0 0 3.7105 0 -50 0.468909 0 0 0 3.7105 0 -51 0.468909 0 0 0 3.7105 0 -52 0.468909 0 0 0 3.7105 0 -53 0.468909 0 0 0 3.7105 0 -54 0.468909 0 0 0 3.7105 0 -55 0.468909 0 0 0 3.7105 0 -56 0.468909 0 0 0 3.7105 0 -57 0.468909 0 0 0 3.7105 0 -58 0.468909 0 0 0 3.7105 0 -59 0.468909 0 0 0 3.73089 0 -60 0.468909 0 0 0 3.75127 0 -61 0.468909 0 0 0 3.77166 0 -62 0.468909 0 0 0 3.81244 0 -63 0.468909 0 0 0 3.85321 0 -64 0.468909 0 0 0 3.89399 0 -65 0.468909 0 0 0 3.93476 0 -66 0.468909 0 0 0 3.97554 0 -67 0.468909 0 0 0 4.01631 0 -68 0.468909 0 0 0 4.05708 0 -69 0.468909 0 0 0 4.09786 0 -70 0.468909 0 0 0 4.13863 0 -71 0.468909 0 0 0 4.17941 0 -72 0.468909 0 0 0 4.22018 0 -73 0.468909 0 0 0 4.26096 0 -74 0.489297 0 0 0 4.32212 0 -75 0.489297 0 0 0 4.38328 0 -76 0.489297 0 0 0 4.42406 0 -77 0.489297 0 0 0 4.46483 0 -78 0.489297 0 0 0 4.50561 0 -79 0.489297 0 0 0 4.54638 0 -80 0.489297 0 0 0 4.58716 0 -81 0.489297 0 0 0 4.62793 0 -82 0.489297 0 0 0 4.66871 0 -83 0.509684 0 0 0 4.70948 0 -84 0.509684 0 0 0 4.75025 0 -85 0.509684 0 0 0 4.79103 0 -86 0.509684 0 0 0 4.8318 0 -87 0.509684 0 0 0 4.91335 0 -88 0.509684 0 0 0 4.9949 0 -89 0.509684 0 0 0 5.05607 0 -90 0.509684 0 0 0 5.09684 0 -91 0.509684 0 0 0 5.158 0 -92 0.570846 0 0 0 5.21916 0 -93 0.632008 0 0 0 5.28033 0 -94 0.632008 0 0 0 5.34149 0 -95 0.632008 0 0 0 5.40265 0 -96 0.632008 0 0 0 5.46381 0 -97 0.632008 0 0 0 5.52497 0 -98 0.632008 0 0 0 5.52497 0 -99 0.632008 0 0 0 5.52497 0 -100 0.632008 0 0 0 5.52497 0 -101 0.632008 0 0 0 5.52497 0 -102 0.632008 0 0 0 5.52497 0 -103 0.632008 0 0 0 5.52497 0 -104 0.632008 0 0 0 5.52497 0 -105 0.632008 0 0 0 5.52497 0 -106 0.632008 0 0 0 5.52497 0 -107 0.632008 0 0 0 5.52497 0 -108 0.632008 0 0 0 5.52497 0 +2 0 0 0 0 0.0611621 0 +3 0 0 0 0 0.0611621 0 +4 0 0 0 0 0.0611621 0 +5 0 0 0 0 0.122324 0 +6 0 0 0 0 0.122324 0 +7 0 0 0 0 0.122324 0 +8 0 0 0 0 0.142712 0 +9 0 0 0 0 0.142712 0 +10 0 0 0 0 0.142712 0 +11 0 0 0 0 0.142712 0 +12 0 0 0 0 0.142712 0 +13 0 0 0 0 0.163099 0 +14 0 0 0 0 0.163099 0 +15 0 0 0 0 0.183486 0 +16 0 0 0 0 0.203874 0 +17 0 0 0 0 0.224261 0 +18 0 0 0 0 0.224261 0 +19 0 0 0 0 0.224261 0 +20 0.122324 0 0 0 0.244648 0 +21 0.122324 0 0 0 0.244648 0 +22 0.122324 0 0 0 0.244648 0 +23 0.122324 0 0 0 0.244648 0 +24 0.122324 0 0 0 0.244648 0 +25 0.122324 0 0 0 0.244648 0 +26 0.122324 0 0 0 0.244648 0 +27 0.142712 0 0 0 0.244648 0 +28 0.183486 0 0 0 0.244648 0 +29 0.224261 0 0 0 0.244648 0 +30 0.224261 0 0 0 0.244648 0 +31 0.224261 0 0 0 0.244648 0 +32 0.224261 0 0 0 0.244648 0 +33 0.224261 0 0 0 0.285423 0 +34 0.224261 0 0 0 0.285423 0 +35 0.265036 0 0 0 0.30581 0 +36 0.285423 0 0 0 0.30581 0 +37 0.326198 0 0 0 0.326198 0 +38 0.407747 0 0 0 0.326198 0 +39 0.468909 0 0 0 0.326198 0 +40 0.468909 0 0 0 0.326198 0 +41 0.468909 0 0 0 0.326198 0 +42 0.468909 0 0 0 0.326198 0 +43 0.468909 0 0 0 0.326198 0 +44 0.468909 0 0 0 0.326198 0 +45 0.468909 0 0 0 0.326198 0 +46 0.468909 0 0 0 0.326198 0 +47 0.468909 0 0 0 0.326198 0 +48 0.468909 0 0 0 0.326198 0 +49 0.468909 0 0 0 0.326198 0 +50 0.468909 0 0 0 0.326198 0 +51 0.468909 0 0 0 0.326198 0 +52 0.468909 0 0 0 0.326198 0 +53 0.468909 0 0 0 0.326198 0 +54 0.468909 0 0 0 0.326198 0 +55 0.468909 0 0 0 0.326198 0 +56 0.468909 0 0 0 0.326198 0 +57 0.468909 0 0 0 0.326198 0 +58 0.468909 0 0 0 0.326198 0 +59 0.468909 0 0 0 0.326198 0 +60 0.468909 0 0 0 0.326198 0 +61 0.468909 0 0 0 0.326198 0 +62 0.468909 0 0 0 0.326198 0 +63 0.468909 0 0 0 0.326198 0 +64 0.468909 0 0 0 0.326198 0 +65 0.468909 0 0 0 0.326198 0 +66 0.468909 0 0 0 0.326198 0 +67 0.468909 0 0 0 0.326198 0 +68 0.468909 0 0 0 0.326198 0 +69 0.468909 0 0 0 0.326198 0 +70 0.468909 0 0 0 0.326198 0 +71 0.468909 0 0 0 0.326198 0 +72 0.468909 0 0 0 0.326198 0 +73 0.468909 0 0 0 0.326198 0 +74 0.468909 0 0 0 0.326198 0 +75 0.468909 0 0 0 0.326198 0 +76 0.468909 0 0 0 0.326198 0 +77 0.468909 0 0 0 0.326198 0 +78 0.468909 0 0 0 0.326198 0 +79 0.468909 0 0 0 0.326198 0 +80 0.468909 0 0 0 0.326198 0 +81 0.468909 0 0 0 0.326198 0 +82 0.468909 0 0 0 0.326198 0 +83 0.468909 0 0 0 0.326198 0 +84 0.468909 0 0 0 0.326198 0 +85 0.468909 0 0 0 0.326198 0 +86 0.468909 0 0 0 0.326198 0 +87 0.468909 0 0 0 0.326198 0 +88 0.468909 0 0 0 0.326198 0 +89 0.468909 0 0 0 0.326198 0 +90 0.468909 0 0 0 0.326198 0 +91 0.468909 0 0 0 0.326198 0 +92 0.468909 0 0 0 0.326198 0 +93 0.468909 0 0 0 0.326198 0 +94 0.468909 0 0 0 0.326198 0 +95 0.468909 0 0 0 0.326198 0 +96 0.468909 0 0 0 0.326198 0 +97 0.468909 0 0 0 0.326198 0 +98 0.468909 0 0 0 0.326198 0 +99 0.468909 0 0 0 0.326198 0 +100 0.468909 0 0 0 0.326198 0 +101 0.468909 0 0 0 0.326198 0 +102 0.468909 0 0 0 0.326198 0 +103 0.468909 0 0 0 0.326198 0 +104 0.468909 0 0 0 0.326198 0 +105 0.468909 0 0 0 0.326198 0 +106 0.468909 0 0 0 0.326198 0 +107 0.468909 0 0 0 0.326198 0 +108 0.468909 0 0 0 0.326198 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_report_bisulfite_summary.txt b/tools/falco/test-data/fastqc_report_bisulfite_summary.txt index 4281c854696..dfd9f170b57 100644 --- a/tools/falco/test-data/fastqc_report_bisulfite_summary.txt +++ b/tools/falco/test-data/fastqc_report_bisulfite_summary.txt @@ -8,4 +8,4 @@ PASS Per base N content 1000trimmed_fastq WARN Sequence Length Distribution 1000trimmed_fastq PASS Sequence Duplication Levels 1000trimmed_fastq WARN Overrepresented sequences 1000trimmed_fastq -WARN Adapter Content 1000trimmed_fastq +PASS Adapter Content 1000trimmed_fastq diff --git a/tools/falco/test-data/fastqc_report_contaminants.html b/tools/falco/test-data/fastqc_report_contaminants.html deleted file mode 100644 index d7a95504ae5..00000000000 --- a/tools/falco/test-data/fastqc_report_contaminants.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:39:23 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : warn

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_customlimits.html b/tools/falco/test-data/fastqc_report_customlimits.html deleted file mode 100644 index b923bc5f79b..00000000000 --- a/tools/falco/test-data/fastqc_report_customlimits.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:40:01 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : warn

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_hisat.html b/tools/falco/test-data/fastqc_report_hisat.html deleted file mode 100644 index 507f4a078f8..00000000000 --- a/tools/falco/test-data/fastqc_report_hisat.html +++ /dev/null @@ -1,187 +0,0 @@ -hisat_output_1_bam FastQC Report
FastQCFastQC Report
Thu 8 Jun 2023
hisat_output_1_bam

[OK]Basic Statistics

MeasureValue
Filenamehisat_output_1_bam
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20
Total Bases1.4 kbp
Sequences flagged as poor quality0
Sequence length70
%GC43

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAG15.0No Hit
TGGCGCTCTCCGTCTTTCTCCATTTCGTCGTGGCCTTGCTATTGACTCTA15.0No Hit
ACCATAAACGCAAGCCTCAACGCAGCGACGAGCACGAGAGCGGTCAGTAG15.0No Hit
TGTTTTCCGTAAATTCAGCGCCTTCCATGATGCGACAGGCCGTTTGAATG15.0No Hit
CTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGT15.0No Hit
TCTGCGTTTGCTGATGAACTAAGTCAACCTCAGCACTAACCTTGCGAGTC15.0No Hit
CCATACAAAACAGGGTCGCCAGCAATATCGGTATAAGTCAAAGCACCTTT15.0No Hit
TAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTCAAG15.0No Hit
CAAATTAGCATAAGCAGCTTGCAGACCCATAATGTCAATAGATGTGGTAG15.0No Hit
GCGTTAAGGTACTGAATCTCTTTAGTCGCAGTAGGCGGAAAACGAACAAG15.0No Hit
CTGAATGGAATTAAGAAAACCACCAATACCAGCATTAACCTTCAAACTAT15.0No Hit
GCGACCATTCAAAGGATAAACATCATAGGCAGTCGGGAGGGTAGTCGGAA15.0No Hit
GTGAAATTTCTAGGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAG15.0No Hit
CTCAAATCCGGCGTCAACCATACCAGCATAGGAAGCATCAGCACCAGCAC15.0No Hit
TTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACC15.0No Hit
CTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATA15.0No Hit
TTAGGTGTGTGTAAAACAGGTGCCGAAGAAGCTGGATTAACAGAATTGAG15.0No Hit
GCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGA15.0No Hit
TTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGTAATT15.0No Hit
CTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAA15.0No Hit

[OK]Adapter Content

Adapter graph

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_kmer.html b/tools/falco/test-data/fastqc_report_kmer.html deleted file mode 100644 index e4a5cb59dcf..00000000000 --- a/tools/falco/test-data/fastqc_report_kmer.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Mon May 27 16:59:30 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : pass

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_min_length.html b/tools/falco/test-data/fastqc_report_min_length.html deleted file mode 100644 index d9309493339..00000000000 --- a/tools/falco/test-data/fastqc_report_min_length.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Mon May 27 17:01:42 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : pass

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_nogroup.html b/tools/falco/test-data/fastqc_report_nogroup.html deleted file mode 100644 index 444964c36d3..00000000000 --- a/tools/falco/test-data/fastqc_report_nogroup.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:40:19 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : warn

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_reverse_complement.html b/tools/falco/test-data/fastqc_report_reverse_complement.html deleted file mode 100644 index 47057a8fc44..00000000000 --- a/tools/falco/test-data/fastqc_report_reverse_complement.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:41:08 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : warn

SequenceCountPercentagePossible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT330.672783No Hit

Adapter Content : warn

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_reverse_complement.txt b/tools/falco/test-data/fastqc_report_reverse_complement.txt index 4cd55952a12..e47fcd7b37c 100644 --- a/tools/falco/test-data/fastqc_report_reverse_complement.txt +++ b/tools/falco/test-data/fastqc_report_reverse_complement.txt @@ -1,4 +1,4 @@ -##Falco 1.2.3 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ Sequence length 1-108 #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content warn +>>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG 1 0 0 0 0 0.0203874 0 -2 0 0 0 0 0.0815494 0 -3 0 0 0 0 0.142712 0 -4 0 0 0 0 0.183486 0 -5 0 0 0 0 0.285423 0 -6 0 0 0 0 0.38736 0 -7 0 0 0 0 0.489297 0 -8 0 0 0 0 0.591233 0 -9 0 0 0 0 0.672783 0 -10 0 0 0 0 0.754332 0 -11 0 0 0 0 0.835882 0 -12 0 0 0 0 0.917431 0 -13 0 0 0 0 1.01937 0 -14 0 0 0 0 1.1213 0 -15 0 0 0 0 1.24363 0 -16 0 0 0 0 1.34557 0 -17 0 0 0 0 1.46789 0 -18 0 0 0 0 1.59021 0 -19 0 0 0 0 1.67176 0 -20 0.122324 0 0 0 1.75331 0 -21 0.122324 0 0 0 1.83486 0 -22 0.122324 0 0 0 1.89602 0 -23 0.122324 0 0 0 1.95719 0 -24 0.122324 0 0 0 2.01835 0 -25 0.122324 0 0 0 2.07951 0 -26 0.122324 0 0 0 2.14067 0 -27 0.142712 0 0 0 2.20183 0 -28 0.183486 0 0 0 2.263 0 -29 0.224261 0 0 0 2.32416 0 -30 0.224261 0 0 0 2.38532 0 -31 0.224261 0 0 0 2.44648 0 -32 0.224261 0 0 0 2.50765 0 -33 0.224261 0 0 0 2.60958 0 -34 0.224261 0 0 0 2.71152 0 -35 0.265036 0 0 0 2.81346 0 -36 0.285423 0 0 0 2.89501 0 -37 0.326198 0 0 0 2.99694 0 -38 0.407747 0 0 0 3.09888 0 -39 0.468909 0 0 0 3.20082 0 -40 0.468909 0 0 0 3.30275 0 -41 0.468909 0 0 0 3.40469 0 -42 0.468909 0 0 0 3.48624 0 -43 0.468909 0 0 0 3.56779 0 -44 0.468909 0 0 0 3.60856 0 -45 0.468909 0 0 0 3.62895 0 -46 0.468909 0 0 0 3.64934 0 -47 0.468909 0 0 0 3.66972 0 -48 0.468909 0 0 0 3.69011 0 -49 0.468909 0 0 0 3.7105 0 -50 0.468909 0 0 0 3.7105 0 -51 0.468909 0 0 0 3.7105 0 -52 0.468909 0 0 0 3.7105 0 -53 0.468909 0 0 0 3.7105 0 -54 0.468909 0 0 0 3.7105 0 -55 0.468909 0 0 0 3.7105 0 -56 0.468909 0 0 0 3.7105 0 -57 0.468909 0 0 0 3.7105 0 -58 0.468909 0 0 0 3.7105 0 -59 0.468909 0 0 0 3.73089 0 -60 0.468909 0 0 0 3.75127 0 -61 0.468909 0 0 0 3.77166 0 -62 0.468909 0 0 0 3.81244 0 -63 0.468909 0 0 0 3.85321 0 -64 0.468909 0 0 0 3.89399 0 -65 0.468909 0 0 0 3.93476 0 -66 0.468909 0 0 0 3.97554 0 -67 0.468909 0 0 0 4.01631 0 -68 0.468909 0 0 0 4.05708 0 -69 0.468909 0 0 0 4.09786 0 -70 0.468909 0 0 0 4.13863 0 -71 0.468909 0 0 0 4.17941 0 -72 0.468909 0 0 0 4.22018 0 -73 0.468909 0 0 0 4.26096 0 -74 0.489297 0 0 0 4.32212 0 -75 0.489297 0 0 0 4.38328 0 -76 0.489297 0 0 0 4.42406 0 -77 0.489297 0 0 0 4.46483 0 -78 0.489297 0 0 0 4.50561 0 -79 0.489297 0 0 0 4.54638 0 -80 0.489297 0 0 0 4.58716 0 -81 0.489297 0 0 0 4.62793 0 -82 0.489297 0 0 0 4.66871 0 -83 0.509684 0 0 0 4.70948 0 -84 0.509684 0 0 0 4.75025 0 -85 0.509684 0 0 0 4.79103 0 -86 0.509684 0 0 0 4.8318 0 -87 0.509684 0 0 0 4.91335 0 -88 0.509684 0 0 0 4.9949 0 -89 0.509684 0 0 0 5.05607 0 -90 0.509684 0 0 0 5.09684 0 -91 0.509684 0 0 0 5.158 0 -92 0.570846 0 0 0 5.21916 0 -93 0.632008 0 0 0 5.28033 0 -94 0.632008 0 0 0 5.34149 0 -95 0.632008 0 0 0 5.40265 0 -96 0.632008 0 0 0 5.46381 0 -97 0.632008 0 0 0 5.52497 0 -98 0.632008 0 0 0 5.52497 0 -99 0.632008 0 0 0 5.52497 0 -100 0.632008 0 0 0 5.52497 0 -101 0.632008 0 0 0 5.52497 0 -102 0.632008 0 0 0 5.52497 0 -103 0.632008 0 0 0 5.52497 0 -104 0.632008 0 0 0 5.52497 0 -105 0.632008 0 0 0 5.52497 0 -106 0.632008 0 0 0 5.52497 0 -107 0.632008 0 0 0 5.52497 0 -108 0.632008 0 0 0 5.52497 0 +2 0 0 0 0 0.0611621 0 +3 0 0 0 0 0.0611621 0 +4 0 0 0 0 0.0611621 0 +5 0 0 0 0 0.122324 0 +6 0 0 0 0 0.122324 0 +7 0 0 0 0 0.122324 0 +8 0 0 0 0 0.142712 0 +9 0 0 0 0 0.142712 0 +10 0 0 0 0 0.142712 0 +11 0 0 0 0 0.142712 0 +12 0 0 0 0 0.142712 0 +13 0 0 0 0 0.163099 0 +14 0 0 0 0 0.163099 0 +15 0 0 0 0 0.183486 0 +16 0 0 0 0 0.203874 0 +17 0 0 0 0 0.224261 0 +18 0 0 0 0 0.224261 0 +19 0 0 0 0 0.224261 0 +20 0.122324 0 0 0 0.244648 0 +21 0.122324 0 0 0 0.244648 0 +22 0.122324 0 0 0 0.244648 0 +23 0.122324 0 0 0 0.244648 0 +24 0.122324 0 0 0 0.244648 0 +25 0.122324 0 0 0 0.244648 0 +26 0.122324 0 0 0 0.244648 0 +27 0.142712 0 0 0 0.244648 0 +28 0.183486 0 0 0 0.244648 0 +29 0.224261 0 0 0 0.244648 0 +30 0.224261 0 0 0 0.244648 0 +31 0.224261 0 0 0 0.244648 0 +32 0.224261 0 0 0 0.244648 0 +33 0.224261 0 0 0 0.285423 0 +34 0.224261 0 0 0 0.285423 0 +35 0.265036 0 0 0 0.30581 0 +36 0.285423 0 0 0 0.30581 0 +37 0.326198 0 0 0 0.326198 0 +38 0.407747 0 0 0 0.326198 0 +39 0.468909 0 0 0 0.326198 0 +40 0.468909 0 0 0 0.326198 0 +41 0.468909 0 0 0 0.326198 0 +42 0.468909 0 0 0 0.326198 0 +43 0.468909 0 0 0 0.326198 0 +44 0.468909 0 0 0 0.326198 0 +45 0.468909 0 0 0 0.326198 0 +46 0.468909 0 0 0 0.326198 0 +47 0.468909 0 0 0 0.326198 0 +48 0.468909 0 0 0 0.326198 0 +49 0.468909 0 0 0 0.326198 0 +50 0.468909 0 0 0 0.326198 0 +51 0.468909 0 0 0 0.326198 0 +52 0.468909 0 0 0 0.326198 0 +53 0.468909 0 0 0 0.326198 0 +54 0.468909 0 0 0 0.326198 0 +55 0.468909 0 0 0 0.326198 0 +56 0.468909 0 0 0 0.326198 0 +57 0.468909 0 0 0 0.326198 0 +58 0.468909 0 0 0 0.326198 0 +59 0.468909 0 0 0 0.326198 0 +60 0.468909 0 0 0 0.326198 0 +61 0.468909 0 0 0 0.326198 0 +62 0.468909 0 0 0 0.326198 0 +63 0.468909 0 0 0 0.326198 0 +64 0.468909 0 0 0 0.326198 0 +65 0.468909 0 0 0 0.326198 0 +66 0.468909 0 0 0 0.326198 0 +67 0.468909 0 0 0 0.326198 0 +68 0.468909 0 0 0 0.326198 0 +69 0.468909 0 0 0 0.326198 0 +70 0.468909 0 0 0 0.326198 0 +71 0.468909 0 0 0 0.326198 0 +72 0.468909 0 0 0 0.326198 0 +73 0.468909 0 0 0 0.326198 0 +74 0.468909 0 0 0 0.326198 0 +75 0.468909 0 0 0 0.326198 0 +76 0.468909 0 0 0 0.326198 0 +77 0.468909 0 0 0 0.326198 0 +78 0.468909 0 0 0 0.326198 0 +79 0.468909 0 0 0 0.326198 0 +80 0.468909 0 0 0 0.326198 0 +81 0.468909 0 0 0 0.326198 0 +82 0.468909 0 0 0 0.326198 0 +83 0.468909 0 0 0 0.326198 0 +84 0.468909 0 0 0 0.326198 0 +85 0.468909 0 0 0 0.326198 0 +86 0.468909 0 0 0 0.326198 0 +87 0.468909 0 0 0 0.326198 0 +88 0.468909 0 0 0 0.326198 0 +89 0.468909 0 0 0 0.326198 0 +90 0.468909 0 0 0 0.326198 0 +91 0.468909 0 0 0 0.326198 0 +92 0.468909 0 0 0 0.326198 0 +93 0.468909 0 0 0 0.326198 0 +94 0.468909 0 0 0 0.326198 0 +95 0.468909 0 0 0 0.326198 0 +96 0.468909 0 0 0 0.326198 0 +97 0.468909 0 0 0 0.326198 0 +98 0.468909 0 0 0 0.326198 0 +99 0.468909 0 0 0 0.326198 0 +100 0.468909 0 0 0 0.326198 0 +101 0.468909 0 0 0 0.326198 0 +102 0.468909 0 0 0 0.326198 0 +103 0.468909 0 0 0 0.326198 0 +104 0.468909 0 0 0 0.326198 0 +105 0.468909 0 0 0 0.326198 0 +106 0.468909 0 0 0 0.326198 0 +107 0.468909 0 0 0 0.326198 0 +108 0.468909 0 0 0 0.326198 0 >>END_MODULE diff --git a/tools/falco/test-data/fastqc_report_reverse_complement_summary.txt b/tools/falco/test-data/fastqc_report_reverse_complement_summary.txt deleted file mode 100644 index 7e94fefb156..00000000000 --- a/tools/falco/test-data/fastqc_report_reverse_complement_summary.txt +++ /dev/null @@ -1,11 +0,0 @@ -PASS Basic Statistics 1000trimmed_fastq -PASS Per base sequence quality 1000trimmed_fastq -FAIL Per tile sequence quality 1000trimmed_fastq -PASS Per sequence quality scores 1000trimmed_fastq -FAIL Per base sequence content 1000trimmed_fastq -WARN Per sequence GC content 1000trimmed_fastq -PASS Per base N content 1000trimmed_fastq -WARN Sequence Length Distribution 1000trimmed_fastq -PASS Sequence Duplication Levels 1000trimmed_fastq -WARN Overrepresented sequences 1000trimmed_fastq -WARN Adapter Content 1000trimmed_fastq diff --git a/tools/falco/test-data/fastqc_report_subsample.html b/tools/falco/test-data/fastqc_report_subsample.html deleted file mode 100644 index b3fc3892e5a..00000000000 --- a/tools/falco/test-data/fastqc_report_subsample.html +++ /dev/null @@ -1,2 +0,0 @@ - 1000trimmed_fastq - report
Report
Sun Sep 1 15:40:37 2024 -
1000trimmed_fastq

Basic Statistics: pass

MeasureValue
Filename1000trimmed_fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4905
Sequences Flagged As Poor Quality0
Sequence length1 - 108
%GC:41

Per base sequence quality: pass

Per tile sequence quality : fail

Per sequence quality scores : pass

Per base sequence content : fail

Per sequence GC content: warn

Per base N content : pass

Sequence Length Distribution : warn

Sequence Duplication Levels : pass

Overrepresented sequences : pass

No overrepresented sequences

Adapter Content : pass

\ No newline at end of file diff --git a/tools/falco/test-data/fastqc_report_subsample.txt b/tools/falco/test-data/fastqc_report_subsample.txt index 601284edbd7..e0059f22fea 100644 --- a/tools/falco/test-data/fastqc_report_subsample.txt +++ b/tools/falco/test-data/fastqc_report_subsample.txt @@ -1,4 +1,4 @@ -##Falco 1.2.3 +##Falco 1.2.4 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1593,110 +1593,110 @@ Sequence length 1-108 #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG 1 0 0 0 0 0 0 2 0 0 0 0 0.0203874 0 -3 0 0 0 0 0.0407747 0 -4 0 0 0 0 0.0407747 0 -5 0 0 0 0 0.0407747 0 -6 0 0 0 0 0.0407747 0 -7 0 0 0 0 0.0407747 0 -8 0 0 0 0 0.0407747 0 -9 0 0 0 0 0.0407747 0 -10 0 0 0 0 0.0407747 0 -11 0 0 0 0 0.0407747 0 -12 0 0 0 0 0.0407747 0 -13 0 0 0 0 0.0407747 0 -14 0 0 0 0 0.0407747 0 -15 0 0 0 0 0.0407747 0 -16 0 0 0 0 0.0407747 0 -17 0 0 0 0 0.0611621 0 -18 0 0 0 0 0.0815494 0 -19 0 0 0 0 0.0815494 0 -20 0.0203874 0 0 0 0.0815494 0 -21 0.0203874 0 0 0 0.0815494 0 -22 0.0203874 0 0 0 0.0815494 0 -23 0.0203874 0 0 0 0.0815494 0 -24 0.0203874 0 0 0 0.0815494 0 -25 0.0203874 0 0 0 0.0815494 0 -26 0.0203874 0 0 0 0.0815494 0 -27 0.0203874 0 0 0 0.0815494 0 -28 0.0203874 0 0 0 0.0815494 0 -29 0.0203874 0 0 0 0.0815494 0 -30 0.0203874 0 0 0 0.0815494 0 -31 0.0203874 0 0 0 0.0815494 0 -32 0.0203874 0 0 0 0.0815494 0 -33 0.0203874 0 0 0 0.0815494 0 -34 0.0203874 0 0 0 0.0815494 0 -35 0.0203874 0 0 0 0.0815494 0 -36 0.0203874 0 0 0 0.0815494 0 -37 0.0203874 0 0 0 0.0815494 0 -38 0.0407747 0 0 0 0.0815494 0 -39 0.0611621 0 0 0 0.0815494 0 -40 0.0611621 0 0 0 0.0815494 0 -41 0.0611621 0 0 0 0.0815494 0 -42 0.0611621 0 0 0 0.0815494 0 -43 0.0611621 0 0 0 0.0815494 0 -44 0.0611621 0 0 0 0.0815494 0 -45 0.0611621 0 0 0 0.0815494 0 -46 0.0611621 0 0 0 0.0815494 0 -47 0.0611621 0 0 0 0.0815494 0 -48 0.0611621 0 0 0 0.0815494 0 -49 0.0611621 0 0 0 0.0815494 0 -50 0.0611621 0 0 0 0.0815494 0 -51 0.0611621 0 0 0 0.0815494 0 -52 0.0611621 0 0 0 0.0815494 0 -53 0.0611621 0 0 0 0.0815494 0 -54 0.0611621 0 0 0 0.0815494 0 -55 0.0611621 0 0 0 0.0815494 0 -56 0.0611621 0 0 0 0.0815494 0 -57 0.0611621 0 0 0 0.0815494 0 -58 0.0611621 0 0 0 0.0815494 0 -59 0.0611621 0 0 0 0.0815494 0 -60 0.0611621 0 0 0 0.0815494 0 -61 0.0611621 0 0 0 0.0815494 0 -62 0.0611621 0 0 0 0.0815494 0 -63 0.0611621 0 0 0 0.0815494 0 -64 0.0611621 0 0 0 0.0815494 0 -65 0.0611621 0 0 0 0.0815494 0 -66 0.0611621 0 0 0 0.0815494 0 -67 0.0611621 0 0 0 0.0815494 0 -68 0.0611621 0 0 0 0.0815494 0 -69 0.0611621 0 0 0 0.0815494 0 -70 0.0611621 0 0 0 0.0815494 0 -71 0.0611621 0 0 0 0.0815494 0 -72 0.0611621 0 0 0 0.0815494 0 -73 0.0611621 0 0 0 0.0815494 0 -74 0.0815494 0 0 0 0.0815494 0 -75 0.0815494 0 0 0 0.0815494 0 -76 0.0815494 0 0 0 0.0815494 0 -77 0.0815494 0 0 0 0.0815494 0 -78 0.0815494 0 0 0 0.0815494 0 -79 0.0815494 0 0 0 0.0815494 0 -80 0.0815494 0 0 0 0.0815494 0 -81 0.0815494 0 0 0 0.0815494 0 -82 0.0815494 0 0 0 0.0815494 0 -83 0.0815494 0 0 0 0.0815494 0 -84 0.0815494 0 0 0 0.0815494 0 -85 0.0815494 0 0 0 0.0815494 0 -86 0.0815494 0 0 0 0.0815494 0 -87 0.0815494 0 0 0 0.0815494 0 -88 0.0815494 0 0 0 0.0815494 0 -89 0.0815494 0 0 0 0.0815494 0 -90 0.0815494 0 0 0 0.0815494 0 -91 0.0815494 0 0 0 0.0815494 0 -92 0.101937 0 0 0 0.0815494 0 -93 0.122324 0 0 0 0.0815494 0 -94 0.122324 0 0 0 0.0815494 0 -95 0.122324 0 0 0 0.0815494 0 -96 0.122324 0 0 0 0.0815494 0 -97 0.122324 0 0 0 0.0815494 0 -98 0.122324 0 0 0 0.0815494 0 -99 0.122324 0 0 0 0.0815494 0 -100 0.122324 0 0 0 0.0815494 0 -101 0.122324 0 0 0 0.0815494 0 -102 0.122324 0 0 0 0.0815494 0 -103 0.122324 0 0 0 0.0815494 0 -104 0.122324 0 0 0 0.0815494 0 -105 0.122324 0 0 0 0.0815494 0 -106 0.122324 0 0 0 0.0815494 0 -107 0.122324 0 0 0 0.0815494 0 -108 0.122324 0 0 0 0.0815494 0 +3 0 0 0 0 0.0203874 0 +4 0 0 0 0 0.0203874 0 +5 0 0 0 0 0.0203874 0 +6 0 0 0 0 0.0203874 0 +7 0 0 0 0 0.0203874 0 +8 0 0 0 0 0.0203874 0 +9 0 0 0 0 0.0203874 0 +10 0 0 0 0 0.0203874 0 +11 0 0 0 0 0.0203874 0 +12 0 0 0 0 0.0203874 0 +13 0 0 0 0 0.0203874 0 +14 0 0 0 0 0.0203874 0 +15 0 0 0 0 0.0203874 0 +16 0 0 0 0 0.0203874 0 +17 0 0 0 0 0.0407747 0 +18 0 0 0 0 0.0407747 0 +19 0 0 0 0 0.0407747 0 +20 0.0203874 0 0 0 0.0407747 0 +21 0.0203874 0 0 0 0.0407747 0 +22 0.0203874 0 0 0 0.0407747 0 +23 0.0203874 0 0 0 0.0407747 0 +24 0.0203874 0 0 0 0.0407747 0 +25 0.0203874 0 0 0 0.0407747 0 +26 0.0203874 0 0 0 0.0407747 0 +27 0.0203874 0 0 0 0.0407747 0 +28 0.0203874 0 0 0 0.0407747 0 +29 0.0203874 0 0 0 0.0407747 0 +30 0.0203874 0 0 0 0.0407747 0 +31 0.0203874 0 0 0 0.0407747 0 +32 0.0203874 0 0 0 0.0407747 0 +33 0.0203874 0 0 0 0.0407747 0 +34 0.0203874 0 0 0 0.0407747 0 +35 0.0203874 0 0 0 0.0407747 0 +36 0.0203874 0 0 0 0.0407747 0 +37 0.0203874 0 0 0 0.0407747 0 +38 0.0407747 0 0 0 0.0407747 0 +39 0.0611621 0 0 0 0.0407747 0 +40 0.0611621 0 0 0 0.0407747 0 +41 0.0611621 0 0 0 0.0407747 0 +42 0.0611621 0 0 0 0.0407747 0 +43 0.0611621 0 0 0 0.0407747 0 +44 0.0611621 0 0 0 0.0407747 0 +45 0.0611621 0 0 0 0.0407747 0 +46 0.0611621 0 0 0 0.0407747 0 +47 0.0611621 0 0 0 0.0407747 0 +48 0.0611621 0 0 0 0.0407747 0 +49 0.0611621 0 0 0 0.0407747 0 +50 0.0611621 0 0 0 0.0407747 0 +51 0.0611621 0 0 0 0.0407747 0 +52 0.0611621 0 0 0 0.0407747 0 +53 0.0611621 0 0 0 0.0407747 0 +54 0.0611621 0 0 0 0.0407747 0 +55 0.0611621 0 0 0 0.0407747 0 +56 0.0611621 0 0 0 0.0407747 0 +57 0.0611621 0 0 0 0.0407747 0 +58 0.0611621 0 0 0 0.0407747 0 +59 0.0611621 0 0 0 0.0407747 0 +60 0.0611621 0 0 0 0.0407747 0 +61 0.0611621 0 0 0 0.0407747 0 +62 0.0611621 0 0 0 0.0407747 0 +63 0.0611621 0 0 0 0.0407747 0 +64 0.0611621 0 0 0 0.0407747 0 +65 0.0611621 0 0 0 0.0407747 0 +66 0.0611621 0 0 0 0.0407747 0 +67 0.0611621 0 0 0 0.0407747 0 +68 0.0611621 0 0 0 0.0407747 0 +69 0.0611621 0 0 0 0.0407747 0 +70 0.0611621 0 0 0 0.0407747 0 +71 0.0611621 0 0 0 0.0407747 0 +72 0.0611621 0 0 0 0.0407747 0 +73 0.0611621 0 0 0 0.0407747 0 +74 0.0611621 0 0 0 0.0407747 0 +75 0.0611621 0 0 0 0.0407747 0 +76 0.0611621 0 0 0 0.0407747 0 +77 0.0611621 0 0 0 0.0407747 0 +78 0.0611621 0 0 0 0.0407747 0 +79 0.0611621 0 0 0 0.0407747 0 +80 0.0611621 0 0 0 0.0407747 0 +81 0.0611621 0 0 0 0.0407747 0 +82 0.0611621 0 0 0 0.0407747 0 +83 0.0611621 0 0 0 0.0407747 0 +84 0.0611621 0 0 0 0.0407747 0 +85 0.0611621 0 0 0 0.0407747 0 +86 0.0611621 0 0 0 0.0407747 0 +87 0.0611621 0 0 0 0.0407747 0 +88 0.0611621 0 0 0 0.0407747 0 +89 0.0611621 0 0 0 0.0407747 0 +90 0.0611621 0 0 0 0.0407747 0 +91 0.0611621 0 0 0 0.0407747 0 +92 0.0611621 0 0 0 0.0407747 0 +93 0.0611621 0 0 0 0.0407747 0 +94 0.0611621 0 0 0 0.0407747 0 +95 0.0611621 0 0 0 0.0407747 0 +96 0.0611621 0 0 0 0.0407747 0 +97 0.0611621 0 0 0 0.0407747 0 +98 0.0611621 0 0 0 0.0407747 0 +99 0.0611621 0 0 0 0.0407747 0 +100 0.0611621 0 0 0 0.0407747 0 +101 0.0611621 0 0 0 0.0407747 0 +102 0.0611621 0 0 0 0.0407747 0 +103 0.0611621 0 0 0 0.0407747 0 +104 0.0611621 0 0 0 0.0407747 0 +105 0.0611621 0 0 0 0.0407747 0 +106 0.0611621 0 0 0 0.0407747 0 +107 0.0611621 0 0 0 0.0407747 0 +108 0.0611621 0 0 0 0.0407747 0 >>END_MODULE diff --git a/tools/falco/test-data/limits.txt b/tools/falco/test-data/limits.txt index 75a12a0acab..017109168a9 100644 --- a/tools/falco/test-data/limits.txt +++ b/tools/falco/test-data/limits.txt @@ -1,81 +1,81 @@ -# For each of the modules you can choose to not run that -# module at all by setting the value below to 1 for the -# modules you want to remove. -duplication ignore 0 -kmer ignore 1 -n_content ignore 0 -overrepresented ignore 0 -quality_base ignore 0 -sequence ignore 0 -gc_sequence ignore 0 -quality_sequence ignore 0 -tile ignore 0 -sequence_length ignore 0 -adapter ignore 0 - -# For the duplication module the value is the percentage -# remaining after deduplication. Measured levels below -# these limits trigger the warning / error. -duplication warn 70 -duplication error 50 - -# For the kmer module the filter is on the -log10 binomial -# pvalue for the most significant Kmer, so 5 would be -# 10^-5 = p<0.00001 -kmer warn 2 -kmer error 5 - -# For the N module the filter is on the percentage of Ns -# at any position in the library -n_content warn 5 -n_content error 20 - -# For the overrepresented seqs the warn value sets the -# threshold for the overrepresented sequences to be reported -# at all as the proportion of the library which must be seen -# as a single sequence -overrepresented warn 0.1 -overrepresented error 1 - -# The per base quality filter uses two values, one for the value -# of the lower quartile, and the other for the value of the -# median quality. Failing either of these will trigger the alert -quality_base_lower warn 10 -quality_base_lower error 5 -quality_base_median warn 25 -quality_base_median error 20 - -# The per base sequence content module tests the maximum deviation -# between A and T or C and G -sequence warn 10 -sequence error 20 - -# The per sequence GC content tests the maximum deviation between -# the theoretical distribution and the real distribution -gc_sequence warn 15 -gc_sequence error 30 - -# The per sequence quality module tests the phred score which is -# most frequently observed -quality_sequence warn 27 -quality_sequence error 20 - -# The per tile module tests the maximum phred score loss between -# and individual tile and the average for that base across all tiles -tile warn 5 -tile error 10 - -# The sequence length module tests are binary, so the values here -# simply turn them on or off. The actual tests warn if you have -# sequences of different length, and error if you have sequences -# of zero length. - -sequence_length warn 1 -sequence_length error 1 - -# The adapter module's warnings and errors are based on the -# percentage of reads in the library which have been observed -# to contain an adapter associated Kmer at any point - -adapter warn 5 -adapter error 10 +# For each of the modules you can choose to not run that +# module at all by setting the value below to 1 for the +# modules you want to remove. +duplication ignore 1 +kmer ignore 1 +n_content ignore 1 +overrepresented ignore 1 +quality_base ignore 1 +sequence ignore 1 +gc_sequence ignore 1 +quality_sequence ignore 1 +tile ignore 1 +sequence_length ignore 0 +adapter ignore 1 + +# For the duplication module the value is the percentage +# remaining after deduplication. Measured levels below +# these limits trigger the warning / error. +duplication warn 70 +duplication error 50 + +# For the kmer module the filter is on the -log10 binomial +# pvalue for the most significant Kmer, so 5 would be +# 10^-5 = p<0.00001 +kmer warn 2 +kmer error 5 + +# For the N module the filter is on the percentage of Ns +# at any position in the library +n_content warn 5 +n_content error 20 + +# For the overrepresented seqs the warn value sets the +# threshold for the overrepresented sequences to be reported +# at all as the proportion of the library which must be seen +# as a single sequence +overrepresented warn 0.1 +overrepresented error 1 + +# The per base quality filter uses two values, one for the value +# of the lower quartile, and the other for the value of the +# median quality. Failing either of these will trigger the alert +quality_base_lower warn 10 +quality_base_lower error 5 +quality_base_median warn 25 +quality_base_median error 20 + +# The per base sequence content module tests the maximum deviation +# between A and T or C and G +sequence warn 10 +sequence error 20 + +# The per sequence GC content tests the maximum deviation between +# the theoretical distribution and the real distribution +gc_sequence warn 15 +gc_sequence error 30 + +# The per sequence quality module tests the phred score which is +# most frequently observed +quality_sequence warn 27 +quality_sequence error 20 + +# The per tile module tests the maximum phred score loss between +# and individual tile and the average for that base across all tiles +tile warn 5 +tile error 10 + +# The sequence length module tests are binary, so the values here +# simply turn them on or off. The actual tests warn if you have +# sequences of different length, and error if you have sequences +# of zero length. + +sequence_length warn 1 +sequence_length error 1 + +# The adapter module's warnings and errors are based on the +# percentage of reads in the library which have been observed +# to contain an adapter associated Kmer at any point + +adapter warn 5 +adapter error 10 diff --git a/tools/falco/test-data/summary.txt b/tools/falco/test-data/summary.txt deleted file mode 100644 index 109484ffc6f..00000000000 --- a/tools/falco/test-data/summary.txt +++ /dev/null @@ -1,11 +0,0 @@ -PASS Basic Statistics 1000trimmed_fastq -PASS Per base sequence quality 1000trimmed_fastq -FAIL Per tile sequence quality 1000trimmed_fastq -PASS Per sequence quality scores 1000trimmed_fastq -FAIL Per base sequence content 1000trimmed_fastq -WARN Per sequence GC content 1000trimmed_fastq -PASS Per base N content 1000trimmed_fastq -WARN Sequence Length Distribution 1000trimmed_fastq -PASS Sequence Duplication Levels 1000trimmed_fastq -WARN Overrepresented sequences 1000trimmed_fastq -PASS Adapter Content 1000trimmed_fastq