Skip to content

Latest commit

 

History

History
79 lines (59 loc) · 4.7 KB

README.md

File metadata and controls

79 lines (59 loc) · 4.7 KB

Six Campy Strains Project


###The following scripts are are used to extract CDS information from 7 Campylobacter strains.

#####Step 1. python extractGB.py ######Extract data (Filename, Strain, DNA_Source, Locus_Tag, Gene Product, Protein_ID, Strand, Transl_Tbl, Seq_AA) from genbank files. NOTE: Multiple gene products (separated by comma) exist for some CDS. This script does not account for this and is dealt with in the r_campy6.R script. ######Input: Genbank Files ######Output: creates text file containing extracted CDS info for each genbank file and campy6_corpus_cds.txt

#####Step 2. Rscript r_campy6.R
######Script to create simple histograms of gene counts (by strain pangenome, by strain chromosome/plasmid) and a gene expression heatmap. This script separates gene products (separated by comma). ######Input: campy6_corpus_cds.txt ######Output: productSplit_campy6_corpus_cds.txt, Plasmid_Chromo_Histogram.png, Pangenome_Histogram.png, gene_heatMap.png

#####Step 3. python gene_comparison.py ######Script does cursory statistics, calculates Jaccard Similarity Coefficient (JSC) & finds genes unique to a particular strain as well as comparing genes between two strains. ######Input: productSplit_campy6_corpus_cds.txt ######Output: campy_statistics.txt, jaccard_statistics.txt, Unique_Genes.txt

#####Step 4. Rscript generate_Jaccard_heatMaps.r ######Creates a heatmap of JSCs. ######Input: jaccard_statistics.txt ######Output: Jaccard_Heatmap.png

#####Step 5. python extract_gene.py ######This script, using start/stop position of gene within genome will find extract the nucleotide sequence from the ORIGIN sequence, convert it to a protein sequence, & compare that to the printed protein sequence of the gene (in CDS section) ######Input: Genome sequence (nucleotide), amino acid sequence from specific gene (along with start/stop position) ######Output: uv_gene.fa

#####Step 6. Align genomes in Mauve using default parameters ######Input: Genebank files (*.gb extension (does not seem to work with *.gbf)) ######Output: Export alignment file

#####Step 7. python format_fasta.py ######This script, places individual reads on single line. Example: ######>header_information ######aagagagacgtatcgatcgatcgat ######gatcgtactactatctacgtgtgatcgt

######becomes:

######>header_information ######aagagagacgtatcgatcgatcgatgatcgtactactatctacgtgtgatcgt ######Input: Alignment file ######Output: Fasta file

#####Step 8. python calculate_orthologIdentity.py ######This script, uses the formatted (step 7) output from Mauve ortholog alignment (across all 7 strains) to calculate sequence similarity (based on positional nucleotides). ######Input: Formatted fasta file (alignment) ######Output: sequenceIdentity.txt

#####Step 9. Rscript compare_strainOrthologs.R ######This script, uses output from step 8 to plot heatmap of strain similarity. ######Input: sequenceIdentity.txt ######Output: seqIdentity.png

#####Step 10. iTol ######Create Phylo tree using iTol (http://itol.embl.de/) ######Input: Alignment tree file (from Mauve) ######Output: Campy_tree.png

#####Step 11. analyse_annotation.py ######This script will open/parse genbank files, extract CDS features, and compare (e.g., calculate sequence identity) the amino acid translation to the sliced & translated nucleotide sequence. If a match or close match, the calculated identity, locus_tag, and accession number are written to _analysisOutput.txt. If a match is not close, the nucleotide slice is written to a fasta file (_unpairedAnnotations.fasta) where the header is comprised of '> ' + locus_tag. Should add argument calls to script in future. ######Input: Genbank file(s) ######Output: *_analysisOutput.txt, *unpairedAnnotations.fasta

#####Step 12. annotation_accuracy.R ######Creates graph of annotation identities to access accuracy of gb file. Should add automated method to label graph in future. The graph may work better as a boxplot. ######Input: *_analysisOutput.txt ######Output: CDSIdentity.png

#####Additional Notes: Some Python scripts only seems to work with .gbf extensions (but Mauve needs .gb extension). As it currently stands, the genbank files are downloaded to a directory (of the same name). For this specific project, the files were split up into multiple files if a plasmid was present, or if the genome had not been fully assembled. All text files will be placed in the "Output:" directory -- should add code to check for directory, and if not present, creates it. Running Python 2.7.10 : Anaconda 2.3.0 (64-bit) : Biopython 1.6.