exercise-sheet-1.Rmd

---
title: "Exercise sheet 1: Biology Basics"
---

---------------------------------

# Exercise 1 - General

Here are some general biology questions. Using the Possible Solutions tab will
convert each question to multiple choice. In the solution only Solutions are ticked.

### 1a)

::: {.question data-latex=""}

Where is the genome stored in prokaryotes and eukaryotes?

::: 


#### {.tabset}

##### Hide



##### Hint : Possible Answers

- [ ] Inside the nucleus in eukaryotes
- [ ] Outside the cell in prokaryotes
- [ ] Prokaryotes have no genome
- [ ] Inside the nucleolus in prokaryotes
- [ ] In chromatin in eukaryotes
- [ ] Partially in mitochondria in prokaryotes
- [ ] Directly inside the cell in prokaryotes



##### Solution

::: {.answer data-latex=""}

- [x] Inside the nucleus in eukaryotes
- [ ] Outside the cell in prokaryotes
- [ ] Prokaryotes have no genome
- [ ] Inside the nucleolus in prokaryotes
- [ ] In chromatin in eukaryotes
- [ ] Partially in mitochondria in prokaryotes
- [x] Directly inside the cell in prokaryotes


::: 

#### {-}


### 1b)

::: {.question data-latex=""}

Name more differences between prokaryotes and eukaryotes?

::: 


#### {.tabset}

##### Hide



##### Hint : Possible Answers

- [ ] Prokaryotes have compartmentation through membrane
- [ ] Eukaryotes are not multi-cellular organisms
- [ ] Prokaryotes have mitochondria
- [ ] Eukaryotes have no nucleus
- [ ] Prokaryotes have no ER
- [ ] Eukaryotes are single cell organisms
- [ ] Eukaryotes have no flagellum



##### Solution

::: {.answer data-latex=""}

- [ ] Prokaryotes have compartmentation through membrane
- [ ] Eukaryotes are not multi-cellular organisms
- [ ] Prokaryotes have mitochondria
- [ ] Eukaryotes have no nucleus
- [x] Prokaryotes have no ER
- [ ] Eukaryotes are single cell organisms
- [ ] Eukaryotes have no flagellum


::: 

#### {-}



### 1c)

::: {.question data-latex=""}

List examples of  prokaryotes and eukaryotes.

::: 


#### {.tabset}

##### Hide



##### Hint : Possible Answers

- [ ] Escherichia coli is a prokaryote
- [ ] Amoebas are prokaryotes
- [ ] Fungi are eukaryotes
- [ ] Archaea are eukaryotes
- [ ] Insects are eukaryotes
- [ ] Salmonella is a prokaryote
- [ ] Plasmodium malariae is a prokaryote



##### Solution

::: {.answer data-latex=""}

- [x] Escherichia coli is a prokaryote
- [ ] Amoebas are prokaryotes
- [x] Fungi are eukaryotes
- [ ] Archaea are eukaryotes
- [x] Insects are eukaryotes
- [x] Salmonella is a prokaryote
- [ ] Plasmodium malariae is a prokaryote

::: 

#### {-}


### 1d)

::: {.question data-latex=""}

What are the three information-carrying biopolymers?

::: 


#### {.tabset}

##### Hide



##### Hint : Possible Answers

- [ ] Protein
- [ ] Cellulose
- [ ] DNA
- [ ] Polysaccharides
- [ ] RNA
- [ ] amino acid
- [ ] nucleotide



##### Solution

::: {.answer data-latex=""}

- [x] Protein
- [x] DNA
- [x] RNA


::: 

#### {-}


### 1e)

::: {.question data-latex=""}

What is denoted by the “Central Dogma” of molecular biology?

::: 


#### {.tabset}

##### Hide



##### Hint : Possible Answers

- [ ] Protein can make Protein
- [ ] DNA can make DNA
- [ ] Protein can make RNA and then RNA makes DNA
- [ ] DNA can make RNA and then RNA makes Protein
- [ ] RNA can make RNA
- [ ] DNA can make RNA and then RNA makes DNA
- [ ] Protein can make DNA



##### Solution

::: {.answer data-latex=""}

- [ ] Protein can make Protein
- [x] DNA can make DNA
- [ ] Protein can make RNA and then RNA makes DNA
- [x] DNA can make RNA and then RNA makes Protein
- [x] RNA can make RNA
- [x] DNA can make RNA and then RNA makes DNA
- [ ] Protein can make DNA


::: 

#### {-}








# Exercise 2 - DNA and RNA
The genetic information of an organism is stored in the DNA in the form of a code. This code consists of four building blocks or bases (`A` for adenine, `C` for cytosine, `G` for guanine, `T` for thymine). These bases or nucleotides follow each other in a certain sequence, e.g.:
```
AGTCGTAATTGGCCCCAATTGCAAAAA
```

A single hereditary unit consists of a subsequence of DNA (called a gene), which contains the information to build a functional RNA or protein molecule.

### 2a)

::: {.question data-latex=""}

Match these terms to the correct number in the figure below: adenine, thymine, cytosine, guanine, uracil, phosphate, deoxyribose, hydrogen bond, backbone, and bases.

:::

```{r, echo=FALSE, out.width="100%", fig.align='center'}
knitr::include_graphics("figures/sheet-1/sheet1-q2.png")
```



#### {.tabset}

##### Hide




##### Hint

1. bases  
2. 
3. deoxyribose
4. 
5. 
6. hydrogen_bond
7. 
8. thymine
9. 
10. backbone


##### Solution



1. bases  
2. phosphate 
3. deoxyribose
4. guanine
5. cytosine
6. hydrogen_bond
7. adenine
8. thymine
9. uracil
10. backbone



#### {-}

### 2b)


::: {.question data-latex=""}

A piece of DNA contains 33% guanine. What are the percentages of adenine, cytosine, and thymine in that piece of DNA?

:::


#### {.tabset}

##### Hide



##### Hint

::: {.question data-latex=""}

What is the percentage of cytosine?

What is the combined percentage of guanine and cytosine?

What is the combined percentage of adenine and thymine?

:::


##### Solution

- guanine: 33%
- cytosine: 33%
- adenine: 17%
- thymine: 17%


#### {-}

### 2c)

::: {.question data-latex=""}

Decide which bases are pyrimidines and which are purines:

- **A** - Adenine
- **C** - Cytosine
- **G** - Guanine 
- **T** - Thymine
- **U** - Uracil.

:::


#### {.tabset}

##### Hide





##### Solution

- pyrimidines: 
  + **C**
  + **T**
  + **U**
- purines: 
  + **A**
  + **G**




#### {-}

### 2d)


::: {.question data-latex=""}

Which of these statements concerning DNA and RNA are correct?



:::


#### {.tabset}

##### Statements

- [ ] Uracil is a standard base in RNA
- [ ] DNA is longer than RNA
- [ ] DNA and RNA have a different structure
- [ ] RNA has an intermolecular double-helix structure
- [ ] RNA contains ribose sugar


##### Solution

- [x] Uracil is a standard base in RNA
- [x] DNA is longer than RNA
- [x] DNA and RNA have a different structure
- [ ] RNA has an intermolecular double-helix structure
- [x] RNA contains ribose sugar


#### {-}

### 2e)

::: {.question data-latex=""}

In what direction is an RNA sequence written?

:::


#### {.tabset}

##### Hide




##### Hint

- [ ] 3' end to 5' end
- [ ] 5' end to 3' end


##### Solution

- [ ] 3' end to 5' end
- [x] 5' end to 3' end



#### {-}

### 2f)

::: {.question data-latex=""}

Why is the RNA sequence written in that direction?

:::


#### {.tabset}

##### Hide




##### Hint: Possible Answers

- [ ] The order is based on the numbering of the carbons in the sugar of the nucleic acid
- [ ] The order is based on the numbering of the carbons in the phosphate of the nucleic acid
- [ ] The order was arbitrarily chosen by the discoverer of RNA


##### Solution

- [x] The order is based on the numbering of the carbons in the sugar of the nucleic acid
- [ ] The order is based on the numbering of the carbons in the phosphate of the nucleic acid
- [ ] The order was arbitrarily chosen by the discoverer of RNA

:::: {#explaining .message-box }

::: {#note-exp .note-header}
```{r, include=knitr::is_html_output(), echo=FALSE,}
knitr::include_graphics("figures/infoicon.svg")
```
**Note**
:::
::: {#note-exp .note-body}


The carbon-atoms in the sugar of the nucleic acid are numbered from 1 to 5.
In the phosphate-sugar backbone, C5 and C4 are the carbon atoms that connect
to the phosphate group so that 5' denotes the end of the chain where C5 is the closest
and 3' denotes the ed where C3 is the closest.

:::
::::




#### {-}

### 2g)


::: {.question data-latex=""}

Decide for the following RNAs whether they are coding or non-coding: mRNA, tRNA, rRNA, microRNA, siRNA, snoRNA

:::

#### {.tabset}

##### Hide



##### Hint

There is only one coding RNA

##### Solution

- coding: mRNA
- non-coding: tRNA, rRNA, microRNA, siRNA, snoRNA

#### {-}

# Exercise 3 - DNA and RNA



### 3a)

What do these acronyms stand for within this course?

- DNA
- RNA
- ncRNA
- mRNA
- UTR
- ORF
- CDS


#### {.tabset}

##### Hide


##### Hint

- [ ] non-coding-RNA
- [ ] Opposite-Reading-Frame
- [ ] Deoxyribonucleic acid
- [ ] non-complementary-RNA
- [ ] missense-RNA
- [ ] messenger-RNA
- [ ] ribonucleic acid
- [ ] untranslated region
- [ ] coding-strand
- [ ] coding-sequence
- [ ] open reading frame

##### Solution

- [x] DNA - Deoxyribonucleic acid
- [x] RNA - Deoxyribonucleic acid
- [x] ncRNA - non-coding-RNA
- [x] mRNA - messenger-RNA
- [x] UTR - untranslated region
- [x] ORF - open reading frame
- [x] CDS - coding-sequence

#### {-}

### 3b)

Check whether the following terms belong to Eukaryotes, Prokaryotes or both.

#### {.tabset}

##### Terms


DNA

- [ ] Eukaryotes
- [ ] Prokaryotes

splicing

- [ ] Eukaryotes
- [ ] Prokaryotes

transcription

- [ ] Eukaryotes
- [ ] Prokaryotes

ncRNA"

- [ ] Eukaryotes
- [ ] Prokaryotes

single-cell-organism

- [ ] Eukaryotes
- [ ] Prokaryotes

##### Hint

DNA

- [ ] Eukaryotes
- [ ] Prokaryotes

splicing

- `r knitr::asis_output("\U2714")` Eukaryotes
- `r knitr::asis_output("\U2716")` Prokaryotes

transcription

- `r knitr::asis_output("\U2714")` Eukaryotes
- `r knitr::asis_output("\U2714")` Prokaryotes

ncRNA"

- [ ] Eukaryotes
- [ ] Prokaryotes

single-cell-organism

- [ ] Eukaryotes
- [ ] Prokaryotes


##### Solution

DNA

- [x] Eukaryotes
- [x] Prokaryotes

splicing

- [x] Eukaryotes
- [ ] Prokaryotes

transcription

- [x] Eukaryotes
- [x] Prokaryotes

ncRNA"

- [x] Eukaryotes
- [x] Prokaryotes

single-cell-organism

- [ ] Eukaryotes
- [x] Prokaryotes

#### {-}


### 3c)

Check whether the  following statements are True or False.


#### {.tabset}

##### Statements



- [ ] The genome is stored in the nucleus
- [ ] FASTA files are used to store sequence information
- [ ] A Watson-Crick base pair describes a pyrimidine pairing with a purine
- [ ] A Watson-Crick base pair describes a purine pairing with a purine
- [ ] RNA is a single stranded bio-polymer

##### Hint

- [ ] The genome is stored in the nucleus
- `r knitr::asis_output("\U2714")` FASTA files are used to store sequence information
- [ ] A Watson-Crick base pair describes a pyrimidine pairing with a purine
- `r knitr::asis_output("\U2716")` A Watson-Crick base pair describes a purine pairing with a purine
- [ ] RNA is a single stranded bio-polymer

##### Solution

- [ ] The genome is stored in the nucleus
- [x] FASTA files are used to store sequence information
- [x] A Watson-Crick base pair describes a pyrimidine pairing with a purine
- [ ] A Watson-Crick base pair describes a purine pairing with a purine
- [ ] RNA is a single stranded bio-polymer

#### {-}

---------------------------------

# Exercise 4 - Programming assignment

Programming assignments are available via Github Classroom and contain automatic tests.

We recommend doing these assignments since they will help you to further understand this topic.

Access the Github Classroom link: [Programming Assignment: Sheet 01](https://classroom.github.com/a/2aXnwTez).

-------------------------------------------