Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

How to calculate AF? #168

Open
EthanW1003 opened this issue Oct 12, 2021 · 0 comments
Open

How to calculate AF? #168

EthanW1003 opened this issue Oct 12, 2021 · 0 comments

Comments

@EthanW1003
Copy link

Dear professor,
Thanks a lot for such a powerful tool.
When I check Allele Frequency (AF), found AF != VD/DP, see example like this:
chr7 55236793 . TTTC T 83 PASS SAMPLE=S1;TYPE=Deletion;DP=436;VD=6;AF=0.0133;BIAS=2:2;REFBIAS=270:169;VARBIAS=1:5;PMEAN=25.7;PSTD=1;QUAL=32.2;QSTD=1;SBF=0.03599;ODDRATIO=7.95226;MQ=60;SN=12;HIAF=0.0149;ADJAF=0;SHIFT3=2;MSI=13;MSILEN=1;NM=3.8;HICNT=6;HICOV=402;LSEQ=GAACCCTGGAGGAATAGCTA;RSEQ=TTTTTTTTTTTTGTCGAGAC;DUPRATE=0;SPLITREAD=0;SPANPAIR=0 GT:DP:VD:AD:AF:RD:ALD 0/1:436:6:439,6:0.0133:270,169:1,5

In which , AF = VD/DP = 6/436 = 0.01376
or something I'm wrong?

look forward to your reply !

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

1 participant