You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Dear professor,
Thanks a lot for such a powerful tool.
When I check Allele Frequency (AF), found AF != VD/DP, see example like this:
chr7 55236793 . TTTC T 83 PASS SAMPLE=S1;TYPE=Deletion;DP=436;VD=6;AF=0.0133;BIAS=2:2;REFBIAS=270:169;VARBIAS=1:5;PMEAN=25.7;PSTD=1;QUAL=32.2;QSTD=1;SBF=0.03599;ODDRATIO=7.95226;MQ=60;SN=12;HIAF=0.0149;ADJAF=0;SHIFT3=2;MSI=13;MSILEN=1;NM=3.8;HICNT=6;HICOV=402;LSEQ=GAACCCTGGAGGAATAGCTA;RSEQ=TTTTTTTTTTTTGTCGAGAC;DUPRATE=0;SPLITREAD=0;SPANPAIR=0 GT:DP:VD:AD:AF:RD:ALD 0/1:436:6:439,6:0.0133:270,169:1,5
In which , AF = VD/DP = 6/436 = 0.01376
or something I'm wrong?
look forward to your reply !
The text was updated successfully, but these errors were encountered:
Dear professor,
Thanks a lot for such a powerful tool.
When I check Allele Frequency (AF), found AF != VD/DP, see example like this:
chr7 55236793 . TTTC T 83 PASS SAMPLE=S1;TYPE=Deletion;DP=436;VD=6;AF=0.0133;BIAS=2:2;REFBIAS=270:169;VARBIAS=1:5;PMEAN=25.7;PSTD=1;QUAL=32.2;QSTD=1;SBF=0.03599;ODDRATIO=7.95226;MQ=60;SN=12;HIAF=0.0149;ADJAF=0;SHIFT3=2;MSI=13;MSILEN=1;NM=3.8;HICNT=6;HICOV=402;LSEQ=GAACCCTGGAGGAATAGCTA;RSEQ=TTTTTTTTTTTTGTCGAGAC;DUPRATE=0;SPLITREAD=0;SPANPAIR=0 GT:DP:VD:AD:AF:RD:ALD 0/1:436:6:439,6:0.0133:270,169:1,5
In which , AF = VD/DP = 6/436 = 0.01376
or something I'm wrong?
look forward to your reply !
The text was updated successfully, but these errors were encountered: